Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter Bank clone, Human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 promoter

Catalog number RDB05893
Resource name pKM2L-phP21
Alternative name p1978-6F
Clone info. PCR amplified human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 promoter sequence was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026). Cloned fragment: 36676033 to 36678769(NC_000006.12); relatively -2646 to +91, where +1 corresponds to 1 nt of NM_000389.4.
PCR cloning, forward primer, 1978 F2: 5' aaaagccagggctgcctctgctcaa 3'; reverse primer, 1978 R2: 5' atccgcgcccagctccggctccaca 3' Entire sequence of promoter region has not been confirmed. (reference: J. Immunol., 172, 5006-5015, 2004, PMID:15067082)
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 genomic DNA
Reference of nucleotide sequence Z85996 (DDBJ accession number)
Depositor|Developer DNA Bank, |
Other clones in our bank human CDKN1A (NCBI Gene 1026) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05893 pKM2L-phP21 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Sequence RDB05893z.seq

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB05893_A3Gop1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40
Sequence file: RDB05893_A3Goa.seq check
Primer: phRLR2
Sequence file: RDB05893_A3Gob.seq check
Primer: pAxCALNL_F1
Sequence file: RDB05893_A3Goc.seq check

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Ishigro, N., ASPL-TFE3 Oncoprotein Regulates Cell Cycle Progression and Induces Cellular Senescence by Up-Regulating p21. Neoplasia 18 (10): 626-635 (2016). PMID 27673450.
user report Suzuki, H., TATA-binding protein (TBP)-like protein is required for p53-dependent transcriptional activation of upstream promoter of p21Waf1/Cip1 gene. J. Biol. Chem., 287 (24): 19792-19803 (2012). PMID 22511763.
user report Matsumura, K., Involvement of the estrogen receptor beta in genistein-induced expression of p21(waf1/cip1) in PC-3 prostate cancer cells. Anticancer Res., 28 (2A): 709-714 (2008). PMID 18507011.
