Resource data sheet
Prev.

pKM2L-phP21

Promoter Bank clone, Human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 promoter

Catalog number RDB05893
Resource name pKM2L-phP21
Alternative name p1978-6F
Clone info. The Human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 promoter sequence (PCR-amplified 2,737 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026).
Forward primer, 1978 F2: 5' aaaagccagggctgcctctgctcaa 3'; Reverse primer, 1978 R2: 5' atccgcgcccagctccggctccaca 3' Entire sequence of promoter region has not been confirmed. (reference: J. Immunol., 172, 5006-5015, 2004, PMID:15067082)
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 genomic DNA
Reference of nucleotide sequence Z85996 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human CDKN1A (NCBI Gene 1026) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05893 pKM2L-phP21 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Sequence RDB05893z.seq from Depositor

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB05893_A3Gop1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB05893_A3Goa.seq
>05893_05893_A3Go_M13(-40)_C10_07.ab1
    1 CCGGCCGGTC CAGCTTGCAT GCCTGCAGGT CATTTAATAG GGATAACAGG GTAATGATTA
   61 AGATCTCGAG CTCTAAGCTT CACATATGCA TGCACTAGTG GCAAAAGCCA GGGCTGCCTC
  121 TGCTCAATAA TGTTCTATCT TTGTTCCGCC TCTTCTCTGG GGTCTCACTT CTTGGGAGCC
  181 TGTGTGAAGG TGAATTCCTC TGAAAGCTGA CTGCCCCTAT TTGGGACTCC CCAGTCTCTT
  241 TCTGAGAAAT GGTGACATTG TTCCCAGCAC TTCCTCTCCC TTCCTAGGCA GCTTCTGCAG
  301 CCACCACTGA GCCTTCCTCA CATCCTCCTT CTTCAGGCTT GGGCTTTCCA CCTTTCACCA
  361 TTCCCCTACC CCATGCTGCT CCACCGCACT CTGGGGAGGG GGCTGGACTG GGCACTCTTG
  421 TCCCCCAGGC TGAGCCTCCC TCCATCCCTA TGCTGCCTGC TTCCCAGGAA CATGCTTGGG
  481 CAGCAGGCTG TGGCTCTGAT TGGCTTTCTG GCCGTCAGGA ACATGTCCCA ACATGTTGAG
  541 CTCTGGCATA GAAGAGGCTG GTGGCTATTT TGTCCTTGGG CTGCCTGTTT TCAGGTGAGG
  601 AAGGGGATGG TAGGAGACAG GAGACCTCTA AAGACCCCAG GTAAACCTTA GCCTGTTACT
  661 CTGAACAGGG TATGTGATCT GCCAGCAGAT CCTTGCGACA GGGCTGGGAT CTGATGCATG
  721 TGTGCTTGTG TGAGTGTGTG CTGGGAGTCA GATTCTGTGT GTGACTTTTA ACAGCCTGCT
  781 CCCTTGCCTT TTTCAGGGCA GAAGTCCTCC CTTAGAGTGT GTCTGGGTAC ACATTCAAGT
  841 GCATGGTTGC AAACTTTTTT TTTTAAAGCA CTGAATAGTA CTAGACACTT AGTAGGTACT
  901 TAAGAAATAT TGAATGTCGT GGTGGTGGTG AGCTAGAAGT TATAAAAAAA ATTCTTTCCC
  961 AAAAACAACA ACAAAAAGAA TTATTTCATT GTGAAGCTCA GTACCACAAA AAATTTAAAT
 1021 AATTCATTTA CAAGCCCTTT ATTAAAAAAA TTTTTCTCCC CAAGTAAAAC AGACAGACAT
 1081 GTCTAGTCTA TTTTGAATTG CTTGAAGGCC AGACGGCCTT CAGCAGTGGG GAGAAGGGTG
1141 CCTGATTCT
//
Primer: phRLR2 RDB05893_A3Gob.seq
>05893_05893_A3Go_phRLR2_D10_10.ab1
    1 AACTTCCTGT CTGAAAGCCC AGTTTCTATT GGTCTCCTTA AACCTGTCTT GTAACCTTGA
   61 TACTTACCTG CCCAGTGCCT CACGACCAAC TTCTGCAGTA CCCGGGTGAA TTCTACGCGT
  121 CGACAGGCAT CCGCGCCCAG CTCCGGCTCC ACAAGGAACT GACTTCGGCA GCTGCTCACA
  181 CCTCAGCTGG CGCAGCTCAG CGCGGCCCTG ATATACAACC GCCCCGCCCG GGCCCGCCTC
  241 AAGGAGGCGG GACCCGCGCT CGGCCCACCG CGCCGCCCGG GACCGCCCTC CCCGGGGCCC
  301 AGGCTCCTGG CTGCCCAGCG CCGAGCCAGC TGAGCCTGGC CGAGTTCCAG CAGGCCAGCC
  361 GGTCCCGGAA CCTCGCGTGC TGCAGGAGGG CACTTCCCTC CTCCCCCAGT CCCTCGCCTG
  421 CGTTGGTGCG CTGGACACAT TTCCCCACGA AGTGAGCCAC AAATCTGGCT TTTTTTACTT
  481 GGAGAATGAG TTGGCACTCT CCAGGAGGAC ACAGCACTGT TAGAATGAGC CCCCTTTCTG
  541 GCTCACCGCT GACCCACTCT GGCAGGCAAG GATTTACCCA ATGCAGCTGA AAAGATCAGG
  601 AGGATGACAT TAATACATAA AAATTCATAA ATTATAAAAA CGATGCACCT CTCTGCAATT
  661 TCCAGAAAAG CCCCACAATA TCACCTCTAT TCCCACTGAT CCCTCACTAG GTCACCTCTC
  721 CCAGAAGCAC CTGGAGCACC TAGACACCCC AACAAAGCAT CTTGAGGCCA GAATGATTTT
  781 TCAGTCCCGT TTATTTCACA GATGAGGAAA TTGAGGTCCA CTGAACTTAA GTATACAAAG
  841 TTGTTGATTG TCACATGCTT CCGGGAAGGA GGGAATTGGA GAGACTACCA AAAAAGGGCA
  901 ACCTGATCTC CAGGGAAACA GAAGAATTGG ACATTGAACC AATCTCCCTA CACCCTACAC
  961 TCACCTGAAC AGAAGAACCC CTGTGGGTTG CAGCAGCTTT GTTGGCCAGG AAGGGAGGAT
 1021 TTGACGAGTG AGTTGTCTGG TCTCTGATAC TCCCCACATA GCCGTATACA CTGCTTGGGA
 1081 AACGGGGGGC TCAGAGTGTC TGATGACGTA TCTCAGATCA ATGCAGCCAA AGAAAATGAA
1141 CCTATATAGG
//
Primer: pAxCALNL_F1 RDB05893_A3Goc.seq
>05893_05893_A3Go_pAxCALNL_F1_F12_06_ABI08.ab1
    1 ACTAGGGAAT CTTTATCATG TCTGCTCGAA GCGGCCGCTC TAGAATTACT GCTCGTTCTT
   61 CAGCACGCGC TCCACGAAGC TCTTGATGTA CTTACCCATT TCATCTGGAG CGTCCTCCTG
  121 GCTGAAGTGG AGGCCCTTCA CCTTCACGAA CTCGGTGTTA GGGAACTTCT TAGCTCCCTC
  181 GACAATAGCG TTGGAAAAGA ACCCAGGGTC GGACTCGATG AACATCTTAG GCAGATCGTC
  241 GCTGGCCCGA AGGTAGGCGT TGTAGTTGCG GACAATCTGG ACGACGTCGG GCTTGCCTCC
  301 CTTAACGAGA GGGATCTCGC GAGGCCAGGA GAGGGTAGGC CGTCTAACCT CGCCCTTCTC
  361 CTTGAATGGC TCCAGGTAGG CAGCGAACTC CTCAGGCTCC AGTTTCCGCA TGATCTTGCT
  421 TGGGAGCATG GTCTCGACGA AGAAGTTATT CTCAAGCACC ATTTTCTCGC CCTCTTCGCT
  481 CTTGATCAGG GCGATATCCT CCTCGATGTC AGGCCACTCG TCCCAGGACT CGATCACGTC
  541 CACGACACTC TCAGCATGGA CGATGGCCTT GATCTTGTCT TGGTGCTCGT AGGAGTAGTG
  601 AAAGGCCAGA CAAGCCCCCC AGTCGTGGCC CACAAAGATG ATTTTCTTTG GAAGGTTCAG
  661 CAGCTCGAAC CAAGCGGTGA GGTACTTGTA GTGATCCAGG AGGCGATATG AGCCATTCCC
  721 GCTCTTGCCG GACTTACCCA TTCCGATCAG ATCAGGGATG ATGCATCTAG CCACGGGCTC
  781 GATGTGAGGC ACGACGTGCC TCCACAGGTA GCTGGAGGCA GCGTTACCAT GCAGAAAAAT
  841 CACGGCGTTT CTCGGCGTGC TTCTCGGGAA TCATAGTAGT TTGATGAAGG AGTCCAGCAC
  901 GTTTCATTTG CTTGCAGCGA AGCCCCACCA CTGAGCCCAG TGATCATGCG TTTGCGTGCT
  961 CGGGGTCGTA CACCTTGGAA GCAATGGTGT CTAGCCTATA GTTGAGTCGT ATAAGGTACT
1021 CTAGCTAGGA GCCTGTAATG GACCTGGTAT GGACCTGTGA AAGCAGCCAA GGTG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Ishigro, N., ASPL-TFE3 Oncoprotein Regulates Cell Cycle Progression and Induces Cellular Senescence by Up-Regulating p21. Neoplasia 18 (10): 626-635 (2016). PMID 27673450.
user report Suzuki, H., TATA-binding protein (TBP)-like protein is required for p53-dependent transcriptional activation of upstream promoter of p21Waf1/Cip1 gene. J. Biol. Chem., 287 (24): 19792-19803 (2012). PMID 22511763.
user report Matsumura, K., Involvement of the estrogen receptor beta in genistein-induced expression of p21(waf1/cip1) in PC-3 prostate cancer cells. Anticancer Res., 28 (2A): 709-714 (2008). PMID 18507011.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl