Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CDKN1A

Gene ID (NCBI) 1026
Gene Symbol CDKN1A
Protein Name cyclin dependent kinase inhibitor 1A
Synonyms CAP20|CDKN1|CIP1|MDA-6|P21|SDI1|WAF1|p21CIP1
Databases KEGG hsa:1026 |  NCBI Gene 1026
Featured content DNA damage
Featured content Jak-STAT signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06625)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01999 pAxCAhp21 Shuttle vector to generate rAd expressing human CDKI p21
RDB03576 pAxCALNLhp21 (forward) Shuttle vector to generate rAd harboring human p21 (forward)
RDB05893 pKM2L-phP21 Promoter Bank clone, Human p21 cyclin dependent kinase inhibitor/WAF1/CIP1 promoter
RDB07302 pGL4-phCDKN1A Promoter collection, Human CDKN1A promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080507 IRAL001E11 pOTB7 BC000312 NM_078467 Full
HGY080638 IRAL001J22 pOTB7 BC013967 NM_078467 Full/var
HGY082404 IRAL006A04 pOTB7 BC000275 NM_078467 Full
HGY083664 IRAL009C16 pOTB7 BC001935 NM_078467 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040292 W01A100M04 pENTR-TOPO IRAL006A04 BC000275 NM_078467  
HGE040300 W01A100M12 pENTR-TOPO IRAL006A04 BC000275 NM_078467 done
HGE040302 W01A100M14 pENTR-TOPO IRAL006A04 BC000275 NM_078467  
HGE051055 W01A127K15 pENTR-TOPO IRAL006A04 BC000275 NM_078467  
HGE051059 W01A127K19 pENTR-TOPO IRAL006A04 BC000275 NM_078467  
HGE051061 W01A127K21 pENTR-TOPO IRAL006A04 BC000275 NM_078467  
HGE051063 W01A127K23 pENTR-TOPO IRAL006A04 BC000275 NM_078467  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052104 ARe30E08 pKA1U5 NM_000389.3  
GGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGCTGGAGCCGGAGCTGGGCGCGGATTC
HKR054028 ARe35B04 pKA1U5 NM_000389.3  
GGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGCTGGAGCCGGAGCTGGGCGCGGATTC
HKR169346 ARi23G02 pGCAP10 NM_000389.3  
GGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGTGGAGCCGGAGCTGGGCGCGGATTCG
HKR185628 ARi64B04 pGCAP10 NM_000389.3  
HKR335683 RBb39D11 pGCAP1 NM_000389.3  
GGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGTGGAGCCGGAGCTGGGCGCGGATTCG
HKR374433 RBd36B09 pGCAP10 NM_000389.3  
GATTTTGTCCTTGGGCTGCCTGTTTTCAGGCGCCATGTCAGAACCGGCTGGGGATGTCCG
HKR381680 RBd54D08 pGCAP10 NM_000389.3  
TGGATGTTGAGCTCTGGCATAGAAGAGGCTGGTGGCTATTTTGTCCTTGGGCTGCCTGTT
HKR474890 RBdS187D18 pGCAP10 NM_000389.3  
GGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGTGGAGCCGGAGCTGGGCGCGGATTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl