Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187N13

Clone ID RBdS187N13
HP ID HP00028
Gene ID 6194
Gene Symbol RPS6
Protein Name ribosomal protein S6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001010.2
Length of RefSeq (bp) 829
Chromosome 9p21
Reference DDBJ accession
UniGene Hs.408073
5'-terminal sequence GCTTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
2011.08.28