Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RPS6

Gene ID (NCBI) 6194
Gene Symbol RPS6
Protein Name ribosomal protein S6
Synonyms S6
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080676 IRAL001L12 pOTB7 BC000524 NM_001010 Full
HGY084184 IRAL010H16 pOTB7 BC013296 NM_001010 Full/var
HGY089509 IRAL023M21 pOTB7 BC009427 NM_001010 Partial
HGY095468 IRAL038L04 pDNR-LIB BC027620 NM_001010 Full/var
HGY103313 IRAL058E17 pOTB7 BC071907 NM_001010 Full
HGY103338 IRAL058F18 pOTB7 BC071908 NM_001010 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040904 ARe02E08 pKA1U5 NM_001010.2  
ATCCTGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACA
HKR043658 ARe09C10 pKA1U5 NM_001010.2  
ATCCTGGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAAC
HKR081284 ARf03D12 pKA1U5 NM_001010.2  
ATCCTGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACA
HKR045682 ARe14D10 pKA1U5 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR045700 ARe14E04 pKA1U5 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR164004 ARi10A04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR164500 ARi11E04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR164856 ARi12C08 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR165611 ARi14A11 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR166573 ARi16H05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR167303 ARi18E07 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR048927 ARe22F07 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR051306 ARe28E10 pKA1U5 NM_001010.2  
GGGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACAT
HKR168012 ARi20A12 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR168474 ARi21D02 pGCAP10 NM_001010.2  
CTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR168873 ARi22D01 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR168900 ARi22E04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGANGAAGCTGAACATCTCC
HKR170122 ARi25F02 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGNNGAAGCTGAACATCTCC
HKR170857 ARi27C09 pGCAP10 NM_001010.2  
TGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
HKR171606 ARi29A06 pGCAP10 NM_001010.2  
AGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGGCTGCCAGAAACTCATT
HKR171659 ARi29C11 pGCAP10 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR052155 ARe30G11 pKA1U5 NM_001010.2  
CTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR053607 ARe34A07 pKA1U5 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR053629 ARe34B05 pKA1U5 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR053684 ARe34D12 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR173208 ARi33A08 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR173681 ARi34D09 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR174530 ARi36F10 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR059299 ARe48E03 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR176411 ARi41A11 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR176454 ARi41C06 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR178884 ARi47D12 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR060807 ARe52A07 pKA1U5 NM_001010.2  
AGCCTCTTTTCCGTGGCGCCNCNGANGCGTTCNCCTGCTTCAAGATGAAGCTGAACATCT
HKR061350 ARe53G06 pKA1U5 NM_001010.2  
CCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR062807 ARe57A07 pKA1U5 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR180106 ARi50E10 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR180548 ARi51G04 pGCAP10 NM_001010.2  
TTGCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
HKR182060 ARi55C12 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR064828 ARe62B04 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR066853 ARe67C05 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR067260 ARe68C12 pKA1U5 NM_001010.2  
ATCCTGGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAAC
HKR067276 ARe68D04 pKA1U5 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR067726 ARe69F06 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR184011 ARi60A11 pGCAP10 NM_001010.2  
GCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTT
HKR185228 ARi63B04 pGCAP10 NM_001010.2  
GGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
HKR185375 ARi63H07 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR068082 ARe70D10 pKA1U5 NM_001010.2  
GCTCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR068499 ARe71E03 pKA1U5 NM_001010.2  
TTGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTTGCTTCAAGATGAAGCTGAACATC
HKR068808 ARe72A08 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR069331 ARe73F11 pKA1U5 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCANCTGCTTCAAGATGAAGCTGAACATCT
HKR069352 ARe73G08 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCNGCTTCAAGATGAAGCTGAACATCTCC
HKR069608 ARe74A08 pKA1U5 NM_001010.2  
GTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGGCTGCCAGAAACTC
HKR071353 ARe78G09 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR075280 ARe88D08 pKA1U5 NM_001010.2  
GAGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGGCTGCCAGAAACTCAT
HKR075633 ARe89B09 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR079377 ARe98H09 pKA1U5 NM_001010.2  
GGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGGCTGCC
HKR203319 ARiS008E23 pGCAP10 NM_001010.2  
GCCCTCTTTTCCGTGNCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR205236 ARiS013B12 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR205330 ARiS013F10 pGCAP10 NM_001010.2  
GCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTT
HKR208286 ARiS020L22 pGCAP10 NM_001010.2  
TGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR209305 ARiS023E09 pGCAP10 NM_001010.2  
TGCTCTTTNCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR218307 ARiS045M19 pGCAP10 NM_001010.2  
GGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGG
HKR219731 ARiS049F11 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR219882 ARiS049L18 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR234196 ARiS085I04 pGCAP10 NM_001010.2  
GTCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR234222 ARiS085J06 pGCAP10 NM_001010.2  
GGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGGCTGCCAGAAAC
HKR234962 ARiS087G18 pGCAP10 NM_001010.2  
CTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR234971 ARiS087H03 pGCAP10 NM_001010.2  
CTCTTTTCCNNGNCNCCTCNNAAGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR235113 ARiS087N01 pGCAP10 NM_001010.2  
HKR235213 ARiS088A13 pGCAP10 NM_001010.2  
CGGCCGGCCGATGCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAA
HKR235351 ARiS088G07 pGCAP10 NM_001010.2  
CTTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTT
HKR235383 ARiS088H15 pGCAP10 NM_001010.2  
GCTCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR238451 ARiS096C03 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR243933 ARiS109N21 pGCAP10 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR247275 ARiS118D03 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR249036 ARiS122J20 pGCAP10 NM_001010.2  
GCTCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR249078 ARiS122L14 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR249143 ARiS122O07 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR264724 ARiS161N12 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR276560 ARiS191G16 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR276600 ARiS191I08 pGCAP10 NM_001010.2  
CTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR277714 ARiS194E18 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR277870 ARiS194L06 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCCACTGGCTGCC
HKR277877 ARiS194L13 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR277923 ARiS194N11 pGCAP10 NM_001010.2  
GCTCTTTNTNGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR320926 RBb02F06 pKA1U5 NM_001010.2  
ATCCTGGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAAC
HKR323683 RBb09D11 pKA1U5 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR360829 RBd02B05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR360901 RBd02E05 pGCAP10 NM_001010.2  
CTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACCTCTCCT
HKR361659 RBd04C11 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR362056 RBd05C08 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR324404 RBb11A04 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR325226 RBb13B02 pKA1U5 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR366077 RBd15D05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR366147 RBd15G03 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR366805 RBd17A05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR366853 RBd17C05 pGCAP10 NM_001010.2  
GCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTT
HKR367349 RBd18G05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR331323 RBb28F03 pGCAP1 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR333378 RBb33H10 pGCAP1 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR333727 RBb34F07 pGCAP1 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR335651 RBb39C03 pGCAP1 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR373351 RBd33G07 pGCAP10 NM_001010.2  
GGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
HKR373625 RBd34B01 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR336401 RBb41A01 pGCAP1 NM_001010.2  
GTTGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
HKR336881 RBb42D09 pGCAP1 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR337257 RBb43C09 pGCAP1 NM_001010.2  
GTGGTGGGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTG
HKR338850 RBb47C02 pGCAP1 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR376850 RBd42C02 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR378930 RBd47F10 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR379373 RBd48H05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR341347 RBb53G03 pGCAP1 NM_001010.2  
TGTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR342179 RBb55H11 pGCAP1 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR342453 RBb56C05 pGCAP1 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR343353 RBb58G09 pGCAP1 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR380011 RBd50A11 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR345727 RBb64F07 pGCAP1 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR346154 RBb65G10 pGCAP1 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR346836 RBb67B12 pGCAP1 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCCGCTGGTTCTAGATGAACCTGAACATCT
HKR384056 RBd60C08 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR384074 RBd60D02 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR384508 RBd61E12 pGCAP10 NM_001010.2  
GCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTT
HKR385300 RBd63E04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR385604 RBd64A04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR386528 RBd66F08 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR387253 RBd68C05 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR388012 RBd70A12 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR388098 RBd70E02 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR388577 RBd71H09 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR390073 RBd75D01 pGCAP10 NM_001010.2  
GGAGGGTTTTCCTGGCGGGGCTGAGGCGTTGGGNGGCTTCCCAANGGAGGCGCCNTCTCC
HKR390123 RBd75F03 pGCAP10 NM_001010.2  
GCTCTTTTCCGGGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR390811 RBd77A11 pGCAP10 NM_001010.2  
GCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTT
HKR391274 RBd78D02 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR391369 RBd78H01 pGCAP10 NM_001010.2  
TGCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR391680 RBd79D08 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR392456 RBd81C08 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR392574 RBd81H06 pGCAP10 NM_001010.2  
GCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCT
HKR395345 RBd88G01 pGCAP10 NM_001010.2  
TTGGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCTTCCCAGCCACTGGCTGCCAGAA
HKR396528 RBd91F08 pGCAP10 NM_001010.2  
AAAGCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACAT
HKR396849 RBd92C01 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR397279 RBd93D07 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR398547 RBd96G03 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR398969 RBd97H01 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR399305 RBd98E09 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR402844 RBdS007B20 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR402981 RBdS007H13 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR403026 RBdS007J10 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR403180 RBdS007P20 pGCAP10 NM_001010.2  
CTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR405847 RBdS014K07 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR406341 RBdS015O05 pGCAP10 NM_001010.2  
TGCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT
HKR408940 RBdS022F20 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR416182 RBdS040H14 pGCAP10 NM_001010.2  
GGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR416291 RBdS040M03 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR420452 RBdS051C04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR420574 RBdS051H06 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR420763 RBdS051P03 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR428161 RBdS070G17 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR433343 RBdS083F23 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR433437 RBdS083J21 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR433567 RBdS083P07 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR433575 RBdS083P15 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR441745 RBdS104G01 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR441926 RBdS104N14 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR444072 RBdS110C24 pGCAP10 NM_001010.2  
GCTTTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR461607 RBdS154A07 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR461723 RBdS154F03 pGCAP10 NM_001010.2  
AGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
HKR461884 RBdS154L20 pGCAP10 NM_001010.2  
GGCTCATCTCGCGAGAACTGAAAGCGCCTATGTGACCTGCGCTAAGCGGAAGTTGGCCCT
HKR461951 RBdS154O15 pGCAP10 NM_001010.2  
GCTCTTTTCCGNGGCGCCTCCNAGGCNTNCAGCTGCTTCAAGATGAANCTGAACATCTCC
HKR461972 RBdS154P12 pGCAP10 NM_001010.2  
GCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTC
HKR471091 RBdS177M03 pGCAP10 NM_001010.2  
ATGTGACCTGCGCTAAGCGGAAGTTGGCCCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAG
HKR474972 RBdS187H04 pGCAP10 NM_001010.2  
GCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCC
HKR475125 RBdS187N13 pGCAP10 NM_001010.2  
GCTTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl