Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187N12

Clone ID RBdS187N12
HP ID HP09296
Gene ID 9886
Gene Symbol RHOBTB1
Protein Name Rho-related BTB domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014836.4
Length of RefSeq (bp) 4515
Chromosome 10q21.2
Reference DDBJ accession
UniGene Hs.148670
5'-terminal sequence GGTCAGTCAGAAAAGATAAGAATCTGGGCTGGACGTGCCACACTGGGGTCTTCTGAAAGT
2011.08.28