Prev. |  KEGG KO K07868 > 

RIKEN DNA Bank Human Resource - RHOBTB1

Gene ID NCBI Gene 9886 |  KEGG hsa:9886
Gene Symbol RHOBTB1
Protein Name Rho related BTB domain containing 1
Synonyms -
Ortholog resource in our bank

  RHOBTB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018870 IRAK047C22 pBluescriptR BC032848 NM_198225 Full
HGY019495 IRAK048M07 pBluescriptR BC041791 NM_198225 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE087644 M01C019B20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087692 M01C019D20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087740 M01C019F20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087788 M01C019H20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087836 M01C019J20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087884 M01C019L20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087932 M01C019N20 pDONR221 IMS02-D10 AK075129 NM_198225  
HGE087980 M01C019P20 pDONR221 IMS02-D10 AK075129 NM_198225  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR475124 RBdS187N12 pGCAP10 NM_014836.4  
GGTCAGTCAGAAAAGATAAGAATCTGGGCTGGACGTGCCACACTGGGGTCTTCTGAAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl