Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187M02

Clone ID RBdS187M02
HP ID HP02080
Gene ID 140823
Gene Symbol ROMO1
Protein Name reactive oxygen species modulator 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_080748.2
Length of RefSeq (bp) 477
Chromosome 20q11.22
Reference DDBJ accession
UniGene Hs.472564
5'-terminal sequence AGCCAAGCTGCTTCGACCGTGTCAAAATGGGCTTCGTGATGGGTTGCGCCGTGGGCATGG
2011.08.28