Prev. | 

RIKEN DNA Bank Human Resource - ROMO1

Gene ID NCBI Gene 140823 |  KEGG hsa:140823
Gene Symbol ROMO1
Protein Name reactive oxygen species modulator 1
Synonyms C20orf52|MTGM|MTGMP|bA353C18.2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088491 IRAL021D19 pDNR-LIB BC008488 NM_080748 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003893 W01A009M05 pENTR-TOPO IRAL021D19 BC008488 NM_080748  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044579 ARe11H11 pKA1U5 NM_080748.2  
AGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACGG
HKR046051 ARe15C03 pKA1U5 NM_080748.2  
GGTCGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGC
HKR060149 ARe50G05 pKA1U5 NM_080748.2  
GGTTTTCCGCTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGATGCCGGTGGC
HKR168412 ARi21A12 pGCAP10 NM_080748.2  
GAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACG
HKR185255 ARi63C07 pGCAP10 NM_080748.2  
AGAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTAC
HKR218239 ARiS045J23 pGCAP10 NM_080748.2  
GGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGATGCCGGTGGCC
HKR219666 ARiS049C18 pGCAP10 NM_080748.2  
GAGAGCTGAGCGACCCAGCCCGCGAGCGAGATGCCGGTGGCCGTGGGTCCCTACGGACAG
HKR219687 ARiS049D15 pGCAP10 NM_080748.2  
GCTCCCCGTCGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTG
HKR238735 ARiS096N23 pGCAP10 NM_080748.2  
GAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACG
HKR243755 ARiS109G11 pGCAP10 NM_080748.2  
GGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGG
HKR249047 ARiS122K07 pGCAP10 NM_080748.2  
CGGCCGGCCGATGGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAG
HKR264513 ARiS161E17 pGCAP10 NM_080748.2  
TGAGAGCTGANCGACCCANCCCGCGAGCGAGATGCCGGTGGCCGTGGGTCCCTACGGACA
HKR276675 ARiS191L11 pGCAP10 NM_080748.2  
GGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTA
HKR361631 RBd04B07 pGCAP10 NM_080748.2  
GATCGGGCCGCGAGCGCCCTCCCCGTCGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCC
HKR363653 RBd09C05 pGCAP10 NM_080748.2  
GGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGATGCCGGTGGCCGTGGGTCCC
HKR368552 RBd21G08 pGCAP10 NM_080748.2  
GGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACGGACAGTCCCAGCCAAGCTGCTT
HKR374980 RBd37H12 pGCAP10 NM_080748.2  
GAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACGGACAGTCCCAGCCAA
HKR377774 RBd44H06 pGCAP10 NM_080748.2  
GGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGATGCCGGTGGCC
HKR383707 RBd59E11 pGCAP10 NM_080748.2  
GAGCGCCCTCCCCGTCGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGC
HKR406026 RBdS015B02 pGCAP10 NM_080748.2  
GAGAGCTGAGCGANNNAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGNGTCCCTACG
HKR408997 RBdS022I05 pGCAP10 NM_080748.2  
GCTCCCCGTCGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTG
HKR428369 RBdS070P09 pGCAP10 NM_080748.2  
GGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGCCGGTGGCCGTGGGTCCCTACGG
HKR444045 RBdS110B21 pGCAP10 NM_080748.2  
GGTCGTTTTCCGTGAGAGACGTAGAGCTGAGCGACCCAGCCCGCGAGCGAGGTGAGATGC
HKR475090 RBdS187M02 pGCAP10 NM_080748.2  
AGCCAAGCTGCTTCGACCGTGTCAAAATGGGCTTCGTGATGGGTTGCGCCGTGGGCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl