Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187K09

Clone ID RBdS187K09
HP ID HP00073
Gene ID 6224
Gene Symbol RPS20
Protein Name ribosomal protein S20
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001023.2
Length of RefSeq (bp) 539
Chromosome 8q12
Reference DDBJ accession
UniGene Hs.8102
5'-terminal sequence GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
2011.08.28