Prev. |  KEGG KO K02969 > 

RIKEN DNA Bank Human Resource - RPS20

Gene ID NCBI Gene 6224 |  KEGG hsa:6224
Gene Symbol RPS20
Protein Name ribosomal protein S20
Synonyms S20
Ortholog resources KEGG ortholog (KEGG orthology K02969) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084038 IRAL010B14 pOTB7 BC007507 NM_001023 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040425 ARe01B01 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR040951 ARe02G07 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR043751 ARe09G07 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR047657 ARe19C09 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR047777 ARe19H09 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR049345 ARe23G01 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR052976 ARe32H08 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR053683 ARe34D11 pKA1U5 NM_001023.2  
GCTTTTTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR057371 ARe43H03 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR059731 ARe49F11 pKA1U5 NM_001023.2  
TGCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR060503 ARe51E07 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR072108 ARe80E12 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR072479 ARe81D07 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR073305 ARe83E09 pKA1U5 NM_001023.2  
GCTTTTTTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCC
HKR076521 ARe91F01 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR078450 ARe96C02 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR164971 ARi12H03 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR169307 ARi23E11 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR170827 ARi27B03 pGCAP10 NM_001023.2  
GCTTTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR171354 ARi28G10 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR175234 ARi38B10 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR176075 ARi40D03 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR176078 ARi40D06 pGCAP10 NM_001023.2  
GCTTTTTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR176153 ARi40G09 pGCAP10 NM_001023.2  
GCTTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTG
HKR183633 ARi59B09 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR209427 ARiS023J11 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR219709 ARiS049E13 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR219921 ARiS049N09 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR219959 ARiS049O23 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR222095 ARiS055D23 pGCAP10 NM_001023.2  
HKR222124 ARiS055F04 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR234145 ARiS085G01 pGCAP10 NM_001023.2  
GCTTTTTGAGGANNNCNCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR247449 ARiS118K09 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR264616 ARiS161I24 pGCAP10 NM_001023.2  
GCTTTTTTTTTGAGGAAGACGCNTTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR279300 ARiS198E04 pGCAP10 NM_001023.2  
GCTNNNNNNTNTNGAGGANNNCNCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTC
HKR321230 RBb03B06 pKA1U5 NM_001023.2  
GCTTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR324879 RBb12D07 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR326805 RBb17A05 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR328126 RBb20F06 pKA1U5 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR338930 RBb47F10 pGCAP1 NM_001023.2  
TCTTTTTTGAGGAAGACGCGGNTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCNTCCTG
HKR364956 RBd12G12 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR368449 RBd21C01 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR378908 RBd47E12 pGCAP10 NM_001023.2  
GCTTTTTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR382146 RBd55G02 pGCAP10 NM_001023.2  
GTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR383604 RBd59A04 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR384104 RBd60E08 pGCAP10 NM_001023.2  
TGCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR386408 RBd66A08 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR388947 RBd72G03 pGCAP10 NM_001023.2  
CGGCCGGCCGATGCTTTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGT
HKR403043 RBdS007K03 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR406346 RBdS015O10 pGCAP10 NM_001023.2  
CGGCCGGCCGATGCTTTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGT
HKR409083 RBdS022L19 pGCAP10 NM_001023.2  
GTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR428044 RBdS070B20 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR428176 RBdS070H08 pGCAP10 NM_001023.2  
GCCTTTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCC
HKR432665 RBdS081L01 pGCAP10 NM_001023.2  
GCTTTTTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR441663 RBdS104C15 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR441856 RBdS104K16 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR442242 RBdS105K02 pGCAP10 NM_001023.2  
GCTTTCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCT
HKR461846 RBdS154K06 pGCAP10 NM_001023.2  
TGCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCT
HKR462618 RBdS156J02 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC
HKR462780 RBdS156P20 pGCAP10 NM_001023.2  
GCNCNTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGC
HKR475049 RBdS187K09 pGCAP10 NM_001023.2  
GCTTTTTGAGGAAGACGCGGTCGTAAGGGCTGAGGATTTTTGGTCCGCACGCTCCTGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl