Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187I08

Clone ID RBdS187I08
HP ID HP02061
Gene ID 10313
Gene Symbol RTN3
Protein Name reticulon 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006054.2
Length of RefSeq (bp) 2583
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.719090
5'-terminal sequence GAGTCAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCA
2011.08.28