Prev. |  KEGG KO K20723 > 

RIKEN DNA Bank Human Resource - RTN3

Gene ID NCBI Gene 10313 |  KEGG hsa:10313
Gene Symbol RTN3
Protein Name reticulon 3
Synonyms ASYIP|HAP|NSPL2|NSPLII|RTN3-A1
Ortholog resources KEGG ortholog (KEGG orthology K20723) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001668 IRAK004C20 pCMV-SPORT6 BC000865 NM_201430

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021450 W01A053K10 pENTR-TOPO flj0027i12 AK075412 NM_006054  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045701 ARe14E05 pKA1U5 NM_006054.2  
GAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTG
HKR048412 ARe21A12 pKA1U5 NM_006054.2  
GAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTG
HKR076128 ARe90F08 pKA1U5 NM_006054.2  
GGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTGCCGGATTATTCTATTTCCCCT
HKR080946 ARf02G02 pKA1U5 NM_006054.2  
GAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTG
HKR170173 ARi25H05 pGCAP10 NM_006054.2  
GGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTGCCGGATTATTCTATTTCCCCTC
HKR222109 ARiS055E13 pGCAP10 NM_006054.2  
GGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTGCCGGA
HKR247333 ARiS118F13 pGCAP10 NM_006054.2  
GAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTG
HKR325351 RBb13G07 pKA1U5 NM_006054.2  
GAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGCAGTAAAGGGACTTGAGCGAGCCAGNTT
HKR339633 RBb49B09 pGCAP1 NM_006054.2  
GGCTCGCGTAGCCATGGCGGAGCCGTCGGCGGCCACTCAGTCCCATTCCATCTCCTCGTC
HKR346832 RBb67B08 pGCAP1 NM_006054.2  
GCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTGCCGGATT
HKR368529 RBd21F09 pGCAP10 NM_006054.2  
GAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCAGTTG
HKR433519 RBdS083N07 pGCAP10 NM_006054.2  
GGCCCTCTAGCTGCGCTCGGCTGAGTCAGTCAGTCTGTCGGAGTCTGTCCTCGGAGCAGG
HKR475000 RBdS187I08 pGCAP10 NM_006054.2  
GAGTCAGTCTGTCGGAGTCTGTCCTCGGAGCAGGCGGAGTAAAGGGACTTGAGCGAGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl