Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187C03

Clone ID RBdS187C03
HP ID HP06373
Gene ID 203069
Gene Symbol R3HCC1
Protein Name R3H domain and coiled-coil containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001136108.1
Length of RefSeq (bp) 1644
Chromosome 8p21.3
Reference DDBJ accession
UniGene Hs.458644
5'-terminal sequence GGCTCGGGCGCGCTGGCCCCTGGGGACGCCGAGGGCGGCTGCGACGCGCCGAGAGGCCGC
2011.08.28