Prev. | 

RIKEN DNA Bank Human Resource - R3HCC1

Gene ID NCBI Gene 203069 |  KEGG hsa:203069
Gene Symbol R3HCC1
Protein Name R3H domain and coiled-coil containing 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025927 IRAK064N15 pCMV-SPORT6 BC032421 XM_939319 Partial/var
HGX042907 IRAK107E11 pCMV-SPORT6 BC050572 XM_939319 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082860 ARf07C12 pKA1U5 NM_001136108.1  
GCTCTCTAGGGCGCTCGGGCGCGCTGGCCCCTGGGGACGCCGAGGGCGGCTGCGACGCGC
HKR203437 ARiS008J21 pGCAP10 NM_001136108.1  
TGGCTGGCCCCTGGGGACGCCGAGGGCGGCTGCGACGCGCCGAGAGGCCGCGGCTCTCCC
HKR243783 ARiS109H15 pGCAP10 NM_001136108.1  
GGGAGAAGTGGAATCTCGTCAGCGCCGCTCCCTGCGCGGGACTCGCGGAACGGCACTGAG
HKR260350 ARiS150O14 pGCAP10 NM_001136108.1  
GGGGGACGCCGAGGGCGGCTGCGACGCGCCGAGAGGCCGCGGCTCTCCCACCTGTCACCC
HKR474851 RBdS187C03 pGCAP10 NM_001136108.1  
GGCTCGGGCGCGCTGGCCCCTGGGGACGCCGAGGGCGGCTGCGACGCGCCGAGAGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl