Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156K06

Clone ID RBdS156K06
HP ID HP05301
Gene ID 80346
Gene Symbol REEP4
Protein Name receptor accessory protein 4
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_025232.2
Length of RefSeq (bp) 1731
Chromosome 8p21.3
Reference DDBJ accession
UniGene Hs.289063
5'-terminal sequence GGCAACTTTCAAGTGAGTTGCGAACTCCGCCCTGTAGGCCGGTGCTGGTGGCCCGGCGCG
2011.08.28