Prev. |  KEGG KO K17338 > 

RIKEN DNA Bank Human Resource - REEP4

Gene ID NCBI Gene 80346 |  KEGG hsa:80346
Gene Symbol REEP4
Protein Name receptor accessory protein 4
Synonyms C8orf20|PP432|Yip2c
Ortholog resource in our bank

  REEP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008608 IRAK021I16 pCMV-SPORT6 BC013048 NM_025232
HGX044381 IRAK110P21 pCMV-SPORT6 BC050622 NM_025232 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092405 M01C031A05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092453 M01C031C05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092501 M01C031E05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092549 M01C031G05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092597 M01C031I05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092645 M01C031K05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092693 M01C031M05 pDONR221 MGC05-A03 BC013048 NM_025232  
HGE092741 M01C031O05 pDONR221 MGC05-A03 BC013048 NM_025232  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182460 ARi56C12 pGCAP10 NM_025232.2  
GACTCGGTTCCGTGCAACTTTCAAGTGAGTTGCGAACTCCGCCCTGTAGGCCGGTGCTGG
HKR324178 RBb10H10 pKA1U5 NM_025232.2  
GACACTGCGCCTGCGTGGCAAGCCGGAGCCCTGGGGTTGGGCAGCACTCGGTTCCGTGCA
HKR462646 RBdS156K06 pGCAP10 NM_025232.2  
GGCAACTTTCAAGTGAGTTGCGAACTCCGCCCTGTAGGCCGGTGCTGGTGGCCCGGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl