Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156J19

Clone ID RBdS156J19
HP ID HP00212
Gene ID 6128
Gene Symbol RPL6
Protein Name ribosomal protein L6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000970.3
Length of RefSeq (bp) 972
Chromosome 12q24.1
Reference DDBJ accession
UniGene Hs.546283
5'-terminal sequence GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
2011.08.28