Prev. |  KEGG KO K02934 > 

RIKEN DNA Bank Human Resource - RPL6

Gene ID NCBI Gene 6128 |  KEGG hsa:6128
Gene Symbol RPL6
Protein Name ribosomal protein L6
Synonyms L6|SHUJUN-2|TAXREB107|TXREB1
Ortholog resources KEGG ortholog (KEGG orthology K02934) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025663 IRAK064C15 pCMV-SPORT6 BC032299 NM_001024662 Full
HGY080939 IRAL002F19 pOTB7 BC004138 NM_001024662 Full
HGY094355 IRAL035O19 pDNR-LIB BC022444 NM_001024662 Full/var
HGY094568 IRAL036G24 pDNR-LIB BC020679 NM_001024662 Full/var
HGY096481 IRAL041D09 pDNR-LIB BC031009 NM_001024662 Full/var
HGY103461 IRAL058K21 pOTB7 BC071912 NM_001024662 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040882 ARe02D10 pKA1U5 NM_000970.3  
GCTTTTCCCATCTTGCAAGATGGCGGGGTGAAAAACTTGAGAAGCCAGATACTAAAGAGA
HKR041297 ARe03E01 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR045771 ARe14H03 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR046807 ARe17A07 pKA1U5 NM_000970.3  
TGCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAG
HKR052832 ARe32B08 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR054428 ARe36B04 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR063602 ARe59A02 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR067774 ARe69H06 pKA1U5 NM_000970.3  
GTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAA
HKR070050 ARe75C02 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAANAGTTGAGAAGCCAGATACTAAAGAGA
HKR070527 ARe76F07 pKA1U5 NM_000970.3  
GACTGTGTTCCTGGTCCTGGGTTCCAGAGGATNACNCTGTAGCCTGTCGCAGCCACGNTT
HKR072152 ARe80G08 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR076951 ARe92G07 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR080452 ARf01C04 pKA1U5 NM_000970.3  
TGTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR080970 ARf02H02 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR081732 ARf04F12 pKA1U5 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR167205 ARi18A05 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR167273 ARi18D01 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCNGATACTAAAGAGA
HKR170132 ARi25F12 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR176503 ARi41E07 pGCAP10 NM_000970.3  
TGCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAG
HKR178078 ARi45D06 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR179379 ARi48H11 pGCAP10 NM_000970.3  
GCTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGA
HKR186405 ARi66A05 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR186459 ARi66C11 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR203428 ARiS008J12 pGCAP10 NM_000970.3  
CGGCCGGCCGATGCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAG
HKR203573 ARiS008P13 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR205418 ARiS013J02 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR234038 ARiS085B14 pGCAP10 NM_000970.3  
TCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR243971 ARiS109P11 pGCAP10 NM_000970.3  
GCTCTTTCCNATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR247459 ARiS118K19 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR260322 ARiS150N10 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR264517 ARiS161E21 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR264727 ARiS161N15 pGCAP10 NM_000970.3  
GCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAAG
HKR264745 ARiS161O09 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR276414 ARiS191A14 pGCAP10 NM_000970.3  
GGCAAGGTAAGAATCGCGGGCCTGTCTGCAAGACTTGAGTTCAGGACTCCCAATCCTTCG
HKR328550 RBb21G06 pKA1U5 NM_000970.3  
ATCCTGTTTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAA
HKR330850 RBb27C02 pGCAP1 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR336974 RBb42H06 pGCAP1 NM_000970.3  
GTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAG
HKR342477 RBb56D05 pGCAP1 NM_000970.3  
CTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAA
HKR346456 RBb66C08 pGCAP1 NM_000970.3  
CTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAA
HKR346879 RBb67D07 pGCAP1 NM_000970.3  
GTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAA
HKR363605 RBd09A05 pGCAP10 NM_000970.3  
GTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAAGA
HKR363655 RBd09C07 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR366148 RBd15G04 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR367674 RBd19D02 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR370170 RBd25H02 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR370955 RBd27G11 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR374049 RBd35C01 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR376051 RBd40C03 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR376129 RBd40F09 pGCAP10 NM_000970.3  
GCTCTTTCCCNTCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGNCAAGGCTGTCGGAGC
HKR376578 RBd41H10 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR376849 RBd42C01 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR377207 RBd43A07 pGCAP10 NM_000970.3  
AATTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAG
HKR377680 RBd44D08 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR378097 RBd45E01 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR378925 RBd47F05 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR378973 RBd47H05 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR380971 RBd52H03 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR382097 RBd55E01 pGCAP10 NM_000970.3  
GCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAANCCNGNTACTAAAGAGAAG
HKR388500 RBd71E04 pGCAP10 NM_000970.3  
GTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAA
HKR392831 RBd82B07 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR395728 RBd89F08 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR396001 RBd90A01 pGCAP10 NM_000970.3  
GACCTTAATTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATA
HKR398904 RBd97E08 pGCAP10 NM_000970.3  
GCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAAG
HKR403003 RBdS007I11 pGCAP10 NM_000970.3  
TGCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAG
HKR405298 RBdS013E02 pGCAP10 NM_000970.3  
GATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGAAGAAACCCG
HKR405391 RBdS013H23 pGCAP10 NM_000970.3  
CGGCCGGCCGATGCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAG
HKR406028 RBdS015B04 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR428074 RBdS070D02 pGCAP10 NM_000970.3  
GCTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGA
HKR430355 RBdS075O19 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR433414 RBdS083I22 pGCAP10 NM_000970.3  
GGGGACCTTAATTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAG
HKR441792 RBdS104H24 pGCAP10 NM_000970.3  
GGGGACCTTAATTCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAG
HKR442191 RBdS105H23 pGCAP10 NM_000970.3  
GGCGGGCCTGTCTGCAAGACTTGAGTTCAGGACTCCCAATCCTTCGCCATCCGAACCTGG
HKR452841 RBdS132B17 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR453137 RBdS132O01 pGCAP10 NM_000970.3  
AGTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR462635 RBdS156J19 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR470905 RBdS177E09 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR474918 RBdS187E22 pGCAP10 NM_000970.3  
GCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGAGA
HKR475010 RBdS187I18 pGCAP10 NM_000970.3  
TGGCTCTTTCCCATCTTGCAAGATGGCGGGTGAAAAAGTTGAGAAGCCAGATACTAAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl