Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156F12

Clone ID RBdS156F12
HP ID HP04369
Gene ID 6199
Gene Symbol RPS6KB2
Protein Name ribosomal protein S6 kinase, 70kD, polypeptide 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003952.2
Length of RefSeq (bp) 1782
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.534345
5'-terminal sequence GAGTCAGTGCGCGGCCAGGTACGGGCCGACGGGCCCGCGGGGCCGGCGCCGCCATGGCGG
2011.08.28