Prev. |  KEGG KO K04688 > 

RIKEN DNA Bank Human Resource - RPS6KB2

Gene ID NCBI Gene 6199 |  KEGG hsa:6199
Gene Symbol RPS6KB2
Protein Name ribosomal protein S6 kinase B2
Synonyms KLS|P70-beta|P70-beta-1|P70-beta-2|S6K-beta2|S6K2|S6KB|S6KI(2)|S6Kbeta|SRK|STK14B|p70(S6K)-beta|p70S6Kb
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  RPS6KB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082972 IRAL007H04 pOTB7 BC000094 NM_003952 Full/var
HGY087220 IRAL018A20 pOTB7 BC006106 NM_003952 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077235 ARe93B11 pKA1U5 NM_003952.2  
GAGTCAGTGCGCGGCCAGGTACGGGCCGACGGGCCCGCGGGGCCGGCGCCGCCATGGCGG
HKR176427 ARi41B03 pGCAP10 NM_003952.2  
GGTTTAGGTCCGGGACTGTCAGTCAGTGCGCGGCCAGGTACGGGCCGACGGGCCCGCGGG
HKR395605 RBd89A05 pGCAP10 NM_003952.2  
GAGGTCCGGGACTGTCAGTCAGTGCGCGGCCAGGTACGGGCCGACGGGCCCGCGGGGCCG
HKR462532 RBdS156F12 pGCAP10 NM_003952.2  
GAGTCAGTGCGCGGCCAGGTACGGGCCGACGGGCCCGCGGGGCCGGCGCCGCCATGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl