Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156E19

Clone ID RBdS156E19
HP ID HP03428
Gene ID 5936
Gene Symbol RBM4
Protein Name RNA binding motif protein 4
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002896.2
Length of RefSeq (bp) 1678
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.533712
5'-terminal sequence GGCCATTTTAGCGTTTTGTCAGAAGCGTCCGCGCCGCGAGGAGGAGGCCCTGCTGGTTTC
2011.08.28