Prev. |  KEGG KO K13187 > 

RIKEN DNA Bank Human Resource - RBM4

Gene ID NCBI Gene 5936 |  KEGG hsa:5936
Gene Symbol RBM4
Protein Name RNA binding motif protein 4
Synonyms LARK|RBM4A|ZCCHC21|ZCRB3A
Ortholog resource in our bank

  RBM4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027874 IRAK069L10 pCMV-SPORT6 BC032735 NM_002896 Full
HGX056168 IRAK140G24 pCMV-SPORT6 BC064960 NM_002896 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006123 W01A015F03 pENTR-TOPO IRAK069L10 BC032735 NM_002896  
HGE006125 W01A015F05 pENTR-TOPO IRAK069L10 BC032735 NM_002896  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061721 ARe54F01 pKA1U5 NM_002896.2  
GGCCATTTTAGCGTTTTGTCAGAAGCGTCCGCGCCGCGAGGAGGAGGCCCTGCTGGTTTC
HKR174808 ARi37A08 pGCAP10 NM_002896.2  
GACAAGGAGAGAGTGCGGCTGCTGAAAGCCGAGCCCAGCAATCCCGATCCTCTGAGTCGT
HKR335750 RBb39G06 pGCAP1 NM_002896.2  
GCCCCCTTCTACTCAGAGCACTGCTGCGGCCGCCGCCATTTTAGCGTTTTGTCAGAAGCG
HKR372403 RBd31A03 pGCAP10 NM_002896.2  
GATTTTAGCGTTTTGTCAGAAGCGTCCGCGCCGCGAGGAGGAGGCCCTGCTGGTTTCTGT
HKR373236 RBd33B12 pGCAP10 NM_002896.2  
GAGAAGCGTCCGCGCCGCGAGGAGGAGGCCCTGCTGGTTTCTGTGCGGGCTCTTGTCAGG
HKR389208 RBd73A08 pGCAP10 NM_002896.2  
GAGAGCACTGCTGCGGCCGCCGCCATTTTAGCGTTTTGTCAGAAGCGTCCGCGCCGCGAG
HKR391776 RBd79H08 pGCAP10 NM_002896.2  
GCCCCTTCTACTCAGAGCACTGCTGCGGCCGCCGCCATTTTAGCGTTTTGTCAGAAGCGT
HKR462515 RBdS156E19 pGCAP10 NM_002896.2  
GGCCATTTTAGCGTTTTGTCAGAAGCGTCCGCGCCGCGAGGAGGAGGCCCTGCTGGTTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl