Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156E15

Clone ID RBdS156E15
HP ID HP00472
Gene ID 6193
Gene Symbol RPS5
Protein Name ribosomal protein S5
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001009.3
Length of RefSeq (bp) 755
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.378103
5'-terminal sequence GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
2011.08.28