Prev. |  KEGG KO K02989 > 

RIKEN DNA Bank Human Resource - RPS5

Gene ID NCBI Gene 6193 |  KEGG hsa:6193
Gene Symbol RPS5
Protein Name ribosomal protein S5
Synonyms S5
Ortholog resources KEGG ortholog (KEGG orthology K02989) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008364 IRAK020P04 pCMV-SPORT6 BC018151 NM_001009 Full
HGX010816 IRAK027A16 pCMV-SPORT6 BC015405 NM_001009 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047773 ARe19H05 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR048810 ARe22A10 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR056931 ARe42F11 pKA1U5 NM_001009.3  
ATCCTGGCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCT
HKR057302 ARe43E06 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR064177 ARe60H09 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR068152 ARe70G08 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR070075 ARe75D03 pKA1U5 NM_001009.3  
GCTTCCTGATCTGTACCAGGGCGGCGCGTGGTCCACNTTCGAAGNTGACAGAGACGCTCA
HKR072082 ARe80D10 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR072130 ARe80F10 pKA1U5 NM_001009.3  
GCTTCCTGCTCTGGTACCAGGGGCGGCGCGGTGGATCATACGCCGAGCTGACAGCANACG
HKR074529 ARe86F09 pKA1U5 NM_001009.3  
GCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGNTGACAGAGACGCTCAGGC
HKR075229 ARe88B05 pKA1U5 NM_001009.3  
GCTCTTCCTGNTCTGTACCAGGGCGGCGCGNTGGNTCTACGCCGAGNTGACAGAGACGCT
HKR161202 ARi03A02 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR161353 ARi03G09 pGCAP10 NM_001009.3  
TCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGCT
HKR163347 ARi08G03 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR167254 ARi18C06 pGCAP10 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGNCAGAGACGCTCAGGC
HKR169352 ARi23G08 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR172884 ARi32D12 pGCAP10 NM_001009.3  
GCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGCT
HKR173249 ARi33C01 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR179283 ARi48D11 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR187258 ARi68C10 pGCAP10 NM_001009.3  
CGCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAG
HKR187628 ARi69B04 pGCAP10 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR203453 ARiS008K13 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGNNCCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR208331 ARiS020N19 pGCAP10 NM_001009.3  
CTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR209283 ARiS023D11 pGCAP10 NM_001009.3  
CTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR218302 ARiS045M14 pGCAP10 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR219736 ARiS049F16 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR222260 ARiS055K20 pGCAP10 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR234298 ARiS085M10 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR243622 ARiS109A22 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR260274 ARiS150L10 pGCAP10 NM_001009.3  
CGGCCGGCCGATGCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACA
HKR277876 ARiS194L12 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR320449 RBb01C01 pKA1U5 NM_001009.3  
TGCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR322473 RBb06D01 pKA1U5 NM_001009.3  
GTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGCTG
HKR322528 RBb06F08 pKA1U5 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR322531 RBb06F11 pKA1U5 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR323234 RBb08B10 pKA1U5 NM_001009.3  
TTGCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCA
HKR329351 RBb23G07 pGCAP1 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGTATTTGACAGAGACGCTCA
HKR330875 RBb27D03 pGCAP1 NM_001009.3  
AATGTGCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACTCCGAGTGACAGAGACGC
HKR332501 RBb31E05 pGCAP1 NM_001009.3  
HKR336084 RBb40D12 pGCAP1 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR336947 RBb42G03 pGCAP1 NM_001009.3  
TGCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAG
HKR338504 RBb46E08 pGCAP1 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTTCTACACCGTAGNTGACAGAGACGCTC
HKR340459 RBb51C11 pGCAP1 NM_001009.3  
TGTCTTCCTGTCTGTACCAGGGCGGCGCGGTGGTCTACGCCGCCCTTTCANTANACGCTC
HKR344434 RBb61B10 pGCAP1 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR347631 RBb69B07 pGCAP1 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR365258 RBd13C10 pGCAP10 NM_001009.3  
GCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGCT
HKR368855 RBd22C07 pGCAP10 NM_001009.3  
HKR368922 RBd22F02 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCNNG
HKR369673 RBd24D01 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR377370 RBd43H02 pGCAP10 NM_001009.3  
GCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGCT
HKR379708 RBd49E12 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR380523 RBd51F03 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR380524 RBd51F04 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR380926 RBd52F06 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR388152 RBd70G08 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR391747 RBd79G03 pGCAP10 NM_001009.3  
GCTCTTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTC
HKR398482 RBd96D10 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR462511 RBdS156E15 pGCAP10 NM_001009.3  
GTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGC
HKR462746 RBdS156O10 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR470826 RBdS177B02 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG
HKR470842 RBdS177B18 pGCAP10 NM_001009.3  
GCTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl