Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154H23

Clone ID RBdS154H23
HP ID HP02048
Gene ID 7879
Gene Symbol RAB7A
Protein Name RAB7A, member RAS oncogene family
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004637.5
Length of RefSeq (bp) 2240
Chromosome 3q21.3
Reference DDBJ accession
UniGene Hs.716392
5'-terminal sequence GGGAGTCTTGGCCATAAAGCCTGAGGCGGCGGCAGCGGCGGAGTTGGCGGCTTGGAGAGC
2011.08.28