Prev. |  KEGG KO K07897 > 

RIKEN DNA Bank Human Resource - RAB7A

Gene ID NCBI Gene 7879 |  KEGG hsa:7879
Gene Symbol RAB7A
Protein Name RAB7A, member RAS oncogene family
Synonyms CMT2B|PRO2706|RAB7
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Mitophagy - human
Ortholog resource in our bank

  RAB7A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008768 IRAK021P08 pCMV-SPORT6 BC013728 NM_004637 Full
HGY080532 IRAL001F12 pOTB7 BC008721 NM_004637 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038621 W01A096J05 pENTR-TOPO flj0066a23 AK000826 NM_004637  
HGE038625 W01A096J09 pENTR-TOPO flj0066a23 AK000826 NM_004637  
HGE038627 W01A096J11 pENTR-TOPO flj0066a23 AK000826 NM_004637  
HGE038629 W01A096J13 pENTR-TOPO flj0066a23 AK000826 NM_004637  
HGE047776 W01A119H08 pENTR-TOPO flj0066a23 AK000826 NM_004637  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041227 ARe03B03 pKA1U5 NM_004637.5  
ACAAACCCTTGTGTCGAGGGCTGACGGCGGAAGTGGGAGCGGGCCTGGAGTCTTGGCCAT
HKR170060 ARi25C12 pGCAP10 NM_004637.5  
GGTCTTGGCCATAAAGCCTGAGGCGGCGGCAGCGGCGGAGTTGGCGGCTTGGAGAGCTCG
HKR173653 ARi34C05 pGCAP10 NM_004637.5  
GGGTGGCGGAAGTGGGAGCGGGCCTGGAGTCTTGGCCATAAAGCCTGAGGCGGCGGCAGC
HKR235364 ARiS088G20 pGCAP10 NM_004637.5  
GTCTTGGCCATAAAGCCTGAGGCGGCGGCAGCGGCGGAGTTGGCGGCTTGGAGAGCTCGG
HKR324406 RBb11A06 pKA1U5 NM_004637.5  
GACTTCCGCTCGGGGCGGCGGCGGTGGCGGAAGTGGGAGCGGGCCTGGAGTCTTGGCCAT
HKR326053 RBb15C05 pKA1U5 NM_004637.5  
GGGGAGCGGGCCTGGTAGTCTTGGCCATAAAGCCTGANGCGGCGGCAGCGGCGGAGTTGG
HKR461791 RBdS154H23 pGCAP10 NM_004637.5  
GGGAGTCTTGGCCATAAAGCCTGAGGCGGCGGCAGCGGCGGAGTTGGCGGCTTGGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl