Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154D02

Clone ID RBdS154D02
HP ID HP02772
Gene ID 5982
Gene Symbol RFC2
Protein Name replication factor C (activator 1) 2, 40kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002914.3
Length of RefSeq (bp) 1613
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.647062
5'-terminal sequence GAGAGGAGGCGCGAGAATGGAGGTGGAGGCCGTCTGTGGTGGCGCGGGCGAGGTGGAGGC
2011.08.28