Prev. |  KEGG KO K10755 > 

RIKEN DNA Bank Human Resource - RFC2

Gene ID NCBI Gene 5982 |  KEGG hsa:5982
Gene Symbol RFC2
Protein Name replication factor C subunit 2
Synonyms RFC40
Ortholog resources KEGG ortholog (KEGG orthology K10755) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084890 IRAL012D18 pOTB7 BC002813 NM_002914 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169725 ARi24F05 pGCAP10 NM_002914.3  
GAGAGGAGGCGCGAGAATGGAGGTGGAGGCCGTCTGTGGTGGCGCGGGCGAGGTGGAGGC
HKR461674 RBdS154D02 pGCAP10 NM_002914.3  
GAGAGGAGGCGCGAGAATGGAGGTGGAGGCCGTCTGTGGTGGCGCGGGCGAGGTGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl