Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154A08

Clone ID RBdS154A08
HP ID HP01831
Gene ID 5935
Gene Symbol RBM3
Protein Name RNA binding motif (RNP1, RRM) protein 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006743.3
Length of RefSeq (bp) 1588
Chromosome Xp11.2
Reference DDBJ accession
UniGene Hs.301404
5'-terminal sequence GACTCTTTATCAATCGTCTTCCGGCGCAGCCCCGTCCCTGTTTTTTGTGCTCCTCCGAGC
2011.08.28