Prev. |  KEGG KO K13186 > 

RIKEN DNA Bank Human Resource - RBM3

Gene ID NCBI Gene 5935 |  KEGG hsa:5935
Gene Symbol RBM3
Protein Name RNA binding motif protein 3
Synonyms IS1-RNPL|RNPL
Ortholog resources KEGG ortholog (KEGG orthology K13186) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001374 IRAK003H06 pCMV-SPORT6 BC006825 NM_001017431 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042923 ARe07F03 pKA1U5 NM_006743.3  
GCCCTGTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTT
HKR073659 ARe84C11 pKA1U5 NM_006743.3  
GCCCTGNTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATT
HKR168525 ARi21F05 pGCAP10 NM_006743.3  
GCCCTGTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTT
HKR176169 ARi40H01 pGCAP10 NM_006743.3  
GCCCTGTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTT
HKR203481 ARiS008L17 pGCAP10 NM_006743.3  
CGGCCGGCCGATGCCCTGTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTT
HKR218233 ARiS045J17 pGCAP10 NM_006743.3  
ATCAATCGTCTTCCGGCGCANCCCCGTCCCTGTTTTTTGTGCTCCTCCGAGCTCGCTGTT
HKR234856 ARiS087C08 pGCAP10 NM_006743.3  
GCCCTGTTTTTTGTGCTCCTCCNAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTT
HKR334127 RBb35F07 pGCAP1 NM_006743.3  
GCCCTGTTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATT
HKR344882 RBb62D10 pGCAP1 NM_006743.3  
HKR360497 RBd01E01 pGCAP10 NM_006743.3  
GACTCTTTATCAATCGTCTTCCGGCGCAGCCCCGTCCCTGTTTTTTGTGCTCCTCCGAGC
HKR360545 RBd01G01 pGCAP10 NM_006743.3  
GACTCTTTATCAATCGTCTTCCGGCGCAGCCCCGTCCCTGTTTTTTGTGCTCCTCCGAGC
HKR386025 RBd65B01 pGCAP10 NM_006743.3  
GCCCTGTTTTTTGTGCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTT
HKR398002 RBd95A02 pGCAP10 NM_006743.3  
TTTTTTTTTTTTTTTTTTTCCAGGACTTGAACTGCCATGTCCTCTGAAGAAGGAAAGCTC
HKR461608 RBdS154A08 pGCAP10 NM_006743.3  
GACTCTTTATCAATCGTCTTCCGGCGCAGCCCCGTCCCTGTTTTTTGTGCTCCTCCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl