Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132K22

Clone ID RBdS132K22
HP ID HP00321
Gene ID 6159
Gene Symbol RPL29
Protein Name ribosomal protein L29
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000992.2
Length of RefSeq (bp) 737
Chromosome 3p21.3-p21.2
Reference DDBJ accession
UniGene Hs.425125
5'-terminal sequence GTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
2011.08.28