Prev. |  KEGG KO K02905 > 

RIKEN DNA Bank Human Resource - RPL29

Gene ID NCBI Gene 6159 |  KEGG hsa:6159
Gene Symbol RPL29
Protein Name ribosomal protein L29
Synonyms HIP|HUMRPL29|L29|RPL29P10|RPL29_3_370
Ortholog resources KEGG ortholog (KEGG orthology K02905) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066663 IRAK166K23 pCMV-SPORT6 BC071663 NM_000992 Full
HGX069752 IRAK174G08 pCMV-SPORT6 BC070481 NM_000992 Full
HGY089830 IRAL024J14 pOTB7 BC008926 NM_000992
HGY103008 IRAL057I16 pDNR-LIB BC070190 NM_000992 Full
HGY103566 IRAL058P06 pOTB7 BC071909 NM_000992 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099215 M01C048A15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099263 M01C048C15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099311 M01C048E15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099359 M01C048G15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099407 M01C048I15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099455 M01C048K15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099503 M01C048M15 pDONR221 MGC13-E08 BC008926 NM_000992  
HGE099551 M01C048O15 pDONR221 MGC13-E08 BC008926 NM_000992  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040474 ARe01D02 pKA1U5 NM_000992.2  
GGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATNGTTTAGACATGGCCAAGNTCCAAGAAC
HKR042929 ARe07F09 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCCCCTTTATGGTGCAGACATGGCCAAGTC
HKR044124 ARe10F04 pKA1U5 NM_000992.2  
GCCCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCC
HKR044882 ARe12D10 pKA1U5 NM_000992.2  
TGGCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGT
HKR046084 ARe15D12 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR048951 ARe22G07 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR049260 ARe23C12 pKA1U5 NM_000992.2  
GAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCA
HKR050859 ARe27C11 pKA1U5 NM_000992.2  
GCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAA
HKR051284 ARe28D12 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR051652 ARe29C04 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR063275 ARe58D03 pKA1U5 NM_000992.2  
GCTTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCA
HKR064834 ARe62B10 pKA1U5 NM_000992.2  
CTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR067346 ARe68G02 pKA1U5 NM_000992.2  
GCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCANTACATGGCCAAGTCCAAGAACCACA
HKR069374 ARe73H06 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCNCCCTTTATGGTGCAGACATGGCCAAGT
HKR070571 ARe76H03 pKA1U5 NM_000992.2  
ACCGCAGCCCCTTTCTCTTCCGGTTCTAGGCNCCNTTTNNAGCCGCGGCTTATGGTGCAG
HKR074899 ARe87E03 pKA1U5 NM_000992.2  
AGCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR076550 ARe91G06 pKA1U5 NM_000992.2  
GTGCCCCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATG
HKR078507 ARe96E11 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR082953 ARf07G09 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR166531 ARi16F11 pGCAP10 NM_000992.2  
GCTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGT
HKR166945 ARi17G01 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR166979 ARi17H11 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR167297 ARi18E01 pGCAP10 NM_000992.2  
GTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR168155 ARi20G11 pGCAP10 NM_000992.2  
GGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACC
HKR168855 ARi22C07 pGCAP10 NM_000992.2  
GTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR169301 ARi23E05 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR171675 ARi29D03 pGCAP10 NM_000992.2  
GCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAA
HKR174010 ARi35A10 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR174956 ARi37G12 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR178459 ARi46C11 pGCAP10 NM_000992.2  
GAGGCGCTTCTGGAGCCCCCCCTTATGGCGCACACTTGGCCCAATACAAAAACCACACCA
HKR180904 ARi52E08 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR186956 ARi67G12 pGCAP10 NM_000992.2  
CTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR188572 ARi71H04 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR203304 ARiS008E08 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR203321 ARiS008F01 pGCAP10 NM_000992.2  
GCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACAC
HKR203538 ARiS008O02 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR205296 ARiS013D24 pGCAP10 NM_000992.2  
GGGGGGTGGACCCCAAGTTCCTGAGGAACATGCGCTTTGCCAAGAAGCACAACAAAAAGG
HKR205324 ARiS013F04 pGCAP10 NM_000992.2  
GCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACAC
HKR208126 ARiS020F06 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR208247 ARiS020K07 pGCAP10 NM_000992.2  
GGAGTGTTGGCCGCGCGGCATCCGATGCCATCCGCGACTTACGGGTGGCGGCGGGGCGCG
HKR222083 ARiS055D11 pGCAP10 NM_000992.2  
TGCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR222351 ARiS055O15 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR234895 ARiS087D23 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR235463 ARiS088K23 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR235474 ARiS088L10 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR235523 ARiS088N11 pGCAP10 NM_000992.2  
TGCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR238718 ARiS096N06 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR260252 ARiS150K12 pGCAP10 NM_000992.2  
TGCTTCCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCA
HKR264465 ARiS161C17 pGCAP10 NM_000992.2  
GCTCTTCNGNTTCTNGNCNCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR277618 ARiS194A18 pGCAP10 NM_000992.2  
GTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR277789 ARiS194H21 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR321777 RBb04H09 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR322878 RBb07D06 pKA1U5 NM_000992.2  
TGGGTTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGC
HKR323748 RBb09G04 pKA1U5 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCCGNTTTATGGTGCAGACATGGCCAAGTC
HKR338879 RBb47D07 pGCAP1 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR339707 RBb49E11 pGCAP1 NM_000992.2  
CTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGNGCNTACATGGCCAAGTCCA
HKR340152 RBb50G08 pGCAP1 NM_000992.2  
GGTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR340578 RBb51H10 pGCAP1 NM_000992.2  
GGTGCTGCACCGCAGCCCCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTAT
HKR342522 RBb56F02 pGCAP1 NM_000992.2  
GAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCA
HKR343732 RBb59F12 pGCAP1 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR346474 RBb66D02 pGCAP1 NM_000992.2  
GTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR365277 RBd13D05 pGCAP10 NM_000992.2  
GCTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGT
HKR368475 RBd21D03 pGCAP10 NM_000992.2  
GCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCACACACAAC
HKR369304 RBd23E08 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR371231 RBd28B07 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR372428 RBd31B04 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR372574 RBd31H06 pGCAP10 NM_000992.2  
GCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACAC
HKR377253 RBd43C05 pGCAP10 NM_000992.2  
TGCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR377657 RBd44C09 pGCAP10 NM_000992.2  
GCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAA
HKR382108 RBd55E12 pGCAP10 NM_000992.2  
GCCTNNTCTNNNNNNCTTCGGGAGCCGCGGNTAATGGTGNANNCNNTTNNCNAGTCCNAN
HKR385655 RBd64C07 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR386172 RBd65H04 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR388097 RBd70E01 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR388404 RBd71A04 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR388570 RBd71H02 pGCAP10 NM_000992.2  
GCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAA
HKR388854 RBd72C06 pGCAP10 NM_000992.2  
GGCAGCCCCTTTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACA
HKR392927 RBd82F07 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR394808 RBd87A08 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR398099 RBd95E03 pGCAP10 NM_000992.2  
GTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR405267 RBdS013C19 pGCAP10 NM_000992.2  
GCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAA
HKR405556 RBdS013O20 pGCAP10 NM_000992.2  
GTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCA
HKR405712 RBdS014E16 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR406285 RBdS015L21 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR408910 RBdS022E14 pGCAP10 NM_000992.2  
GGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCACACACAACCAGTCCCG
HKR416240 RBdS040J24 pGCAP10 NM_000992.2  
GCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAAC
HKR420576 RBdS051H08 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR432583 RBdS081H15 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR433480 RBdS083L16 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR441843 RBdS104K03 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR444138 RBdS110F18 pGCAP10 NM_000992.2  
TGCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR444171 RBdS110H03 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC
HKR452802 RBdS132A02 pGCAP10 NM_000992.2  
GAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCA
HKR452902 RBdS132E06 pGCAP10 NM_000992.2  
GAGTAGTACTTTCCGGCGTTGTTGACCCTATTTCCCGTGCTGCACCGCAGCCCCTTTCTC
HKR453062 RBdS132K22 pGCAP10 NM_000992.2  
GTCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTC
HKR462639 RBdS156J23 pGCAP10 NM_000992.2  
GCTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl