Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110K09

Clone ID RBdS110K09
HP ID HP05014
Gene ID 51255
Gene Symbol RNF181
Protein Name ring finger protein 181
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016494.3
Length of RefSeq (bp) 716
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.356187
5'-terminal sequence TGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTCGGACCC
2011.08.28