Prev. | 

RIKEN DNA Bank Human Resource - RNF181

Gene ID NCBI Gene 51255 |  KEGG hsa:51255
Gene Symbol RNF181
Protein Name ring finger protein 181
Synonyms HSPC238
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084838 IRAL012B14 pOTB7 BC002803 NM_016494 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050979 ARe27H11 pKA1U5 NM_016494.3  
GGTCAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTCGG
HKR082180 ARf05H12 pKA1U5 NM_016494.3  
GGTGTCAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTC
HKR234224 ARiS085J08 pGCAP10 NM_016494.3  
GGTGTCAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTC
HKR235568 ARiS088P08 pGCAP10 NM_016494.3  
GAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTCGGACC
HKR238502 ARiS096E06 pGCAP10 NM_016494.3  
GAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTCGGACC
HKR377633 RBd44B09 pGCAP10 NM_016494.3  
GGAGCAGGGTCCGAGGGCTGTGTCAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGA
HKR379774 RBd49H06 pGCAP10 NM_016494.3  
GGTGTCAGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTC
HKR392004 RBd80A04 pGCAP10 NM_016494.3  
GGGCCAGCGCCGCTAGGCCGCTATCGAGCAGGGTCCGAGGGCTGTGTCAGAAGGCTGGGC
HKR444249 RBdS110K09 pGCAP10 NM_016494.3  
TGAAGGCTGGGCAGCCATGGCGTCCTATTTCGATGAACACGACTGCGAGCCGTCGGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl