Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105G01

Clone ID RBdS105G01
HP ID HP01947
Gene ID 8607
Gene Symbol RUVBL1
Protein Name RuvB-like 1 (E. coli)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003707.2
Length of RefSeq (bp) 1785
Chromosome 3q21
Reference DDBJ accession
UniGene Hs.272822
5'-terminal sequence GGCGCACTGTCCTAGCTGCTGGTTTTCCACGCTGGTTTTAGCTCCCGGCGTCTGCAAAAT
2011.08.28