Prev. |  KEGG KO K04499 > 

RIKEN DNA Bank Human Resource - RUVBL1

Gene ID NCBI Gene 8607 |  KEGG hsa:8607
Gene Symbol RUVBL1
Protein Name RuvB like AAA ATPase 1
Synonyms ECP-54|ECP54|INO80H|NMP 238|NMP238|PONTIN|Pontin52|RVB1|TIH1|TIP49|TIP49A
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  RUVBL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008691 IRAK021M03 pCMV-SPORT6 BC012886 NM_003707 Full
HGY083854 IRAL009K14 pOTB7 BC002993 NM_003707 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442145 RBdS105G01 pGCAP10 NM_003707.2  
GGCGCACTGTCCTAGCTGCTGGTTTTCCACGCTGGTTTTAGCTCCCGGCGTCTGCAAAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl