Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105F06

Clone ID RBdS105F06
HP ID HP00470
Gene ID 6209
Gene Symbol RPS15
Protein Name ribosomal protein S15
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001018.3
Length of RefSeq (bp) 531
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.406683
5'-terminal sequence GGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTC
2011.08.28