Prev. |  KEGG KO K02958 > 

RIKEN DNA Bank Human Resource - RPS15

Gene ID NCBI Gene 6209 |  KEGG hsa:6209
Gene Symbol RPS15
Protein Name ribosomal protein S15
Synonyms RIG|S15
Ortholog resources KEGG ortholog (KEGG orthology K02958) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056109 IRAK140E13 pCMV-SPORT6 BC064908 NM_001018 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040482 ARe01D10 pKA1U5 NM_001018.3  
ATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCC
HKR042924 ARe07F04 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR043657 ARe09C09 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR045258 ARe13C10 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR046129 ARe15F09 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR047326 ARe18F06 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR047705 ARe19E09 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR048098 ARe20E02 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR052572 ARe31H04 pKA1U5 NM_001018.3  
GGCGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACC
HKR055306 ARe38E10 pKA1U5 NM_001018.3  
TGTGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR055730 ARe39F10 pKA1U5 NM_001018.3  
ATCCTGGGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGA
HKR057655 ARe44C07 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTCCANTNAGAAGAAGAAGCGGACCTTCC
HKR060501 ARe51E05 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR060858 ARe52C10 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTNCNANNAGAAGAAGAAGCGGACCTTCC
HKR064972 ARe62H04 pKA1U5 NM_001018.3  
GCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCA
HKR068908 ARe72E12 pKA1U5 NM_001018.3  
GGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTC
HKR072035 ARe80B11 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR072459 ARe81C11 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR073748 ARe84G04 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR160407 ARi01A07 pGCAP10 NM_001018.3  
GGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR163627 ARi09B03 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR174928 ARi37F08 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR175373 ARi38H05 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR177300 ARi43E04 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR180049 ARi50C01 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR184430 ARi61B06 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR185325 ARi63F05 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR188104 ARi70E08 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR218200 ARiS045I08 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR219707 ARiS049E11 pGCAP10 NM_001018.3  
GTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGC
HKR243785 ARiS109H17 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR247239 ARiS118B15 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR260189 ARiS150H21 pGCAP10 NM_001018.3  
CGGCCGGCCGATGTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAG
HKR320436 RBb01B12 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR324076 RBb10D04 pKA1U5 NM_001018.3  
GCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGTAGAAGAAGAAGCGGACCTTCCGCA
HKR325683 RBb14D11 pKA1U5 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGCCCCATTAGAAGAAGAAGCGGACCTTCC
HKR331232 RBb28B08 pGCAP1 NM_001018.3  
TGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCC
HKR331704 RBb29E08 pGCAP1 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR332076 RBb30D04 pGCAP1 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR332404 RBb31A04 pGCAP1 NM_001018.3  
HKR332425 RBb31B01 pGCAP1 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR338172 RBb45H04 pGCAP1 NM_001018.3  
GTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAA
HKR341726 RBb54F06 pGCAP1 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR342025 RBb55B01 pGCAP1 NM_001018.3  
AATGTGGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGAC
HKR347306 RBb68E10 pGCAP1 NM_001018.3  
TTTTTAAAGCGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAA
HKR360403 RBd01A03 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAG
HKR360435 RBd01B11 pGCAP10 NM_001018.3  
GCTCTTCTCGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCC
HKR362480 RBd06D08 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR362955 RBd07G11 pGCAP10 NM_001018.3  
GAAAAGCGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCG
HKR364132 RBd10F12 pGCAP10 NM_001018.3  
GGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR364923 RBd12F03 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR367651 RBd19C03 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR368149 RBd20G05 pGCAP10 NM_001018.3  
GGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR368499 RBd21E03 pGCAP10 NM_001018.3  
GATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTC
HKR369279 RBd23D07 pGCAP10 NM_001018.3  
GATGCCGGCAGTCTCGCGATAACTGCGCAGGCGCGGACCAAAGCGATCTCTTCTGAGGAT
HKR370004 RBd25A04 pGCAP10 NM_001018.3  
TGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCC
HKR370978 RBd27H10 pGCAP10 NM_001018.3  
GGGCAGTCTCGCGATAACTGCGCAGGCGCGGACCAAAGCGATCTCTTCTGAGGATCCGGC
HKR372479 RBd31D07 pGCAP10 NM_001018.3  
GGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR372827 RBd32B03 pGCAP10 NM_001018.3  
HKR373301 RBd33E05 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAG
HKR376503 RBd41E07 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR377209 RBd43A09 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR378484 RBd46D12 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR380879 RBd52D07 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR383636 RBd59B12 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR383659 RBd59C11 pGCAP10 NM_001018.3  
GAGGCGCGGACCAAAGCGATCTCTTCTGAGGATCCGGCAAGATGGCAAAAGTAGAGCAGA
HKR384876 RBd62D04 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR388169 RBd70H01 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR392075 RBd80D03 pGCAP10 NM_001018.3  
GGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTT
HKR393755 RBd84G11 pGCAP10 NM_001018.3  
TGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCC
HKR394180 RBd85H12 pGCAP10 NM_001018.3  
CGGCCGGCCGATGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAA
HKR394449 RBd86C01 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR394948 RBd87G04 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR396103 RBd90E07 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR397306 RBd93E10 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR405778 RBdS014H10 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR408919 RBdS022E23 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR409045 RBdS022K05 pGCAP10 NM_001018.3  
HKR409082 RBdS022L18 pGCAP10 NM_001018.3  
TTGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTC
HKR416142 RBdS040F22 pGCAP10 NM_001018.3  
GAGCGATCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGAC
HKR416234 RBdS040J18 pGCAP10 NM_001018.3  
GCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCA
HKR420500 RBdS051E04 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR420676 RBdS051L12 pGCAP10 NM_001018.3  
GCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGT
HKR430154 RBdS075G10 pGCAP10 NM_001018.3  
TTGCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTC
HKR430204 RBdS075I12 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR430379 RBdS075P19 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR442111 RBdS105E15 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR442126 RBdS105F06 pGCAP10 NM_001018.3  
GGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTC
HKR452838 RBdS132B14 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR453102 RBdS132M14 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR453178 RBdS132P18 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR461844 RBdS154K04 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGGCAGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCG
HKR461910 RBdS154M22 pGCAP10 NM_001018.3  
GGCGATTTGGCGCGTCTCTGCCGGGCCTATCCGGCTCCATCCAACCTCTGACCGTCTCGC
HKR462416 RBdS156A16 pGCAP10 NM_001018.3  
GCTCTTCTGAGGATCCGGCAAGATGAAGTAGAGCAGAAGAAGAAGCGGACCTTCCGCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl