Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104L17

Clone ID RBdS104L17
HP ID HP03992
Gene ID 51187
Gene Symbol C15orf15
Protein Name chromosome 15 open reading frame 15
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016304.2
Length of RefSeq (bp) 1487
Chromosome 15q21
Reference DDBJ accession
UniGene Hs.274772
5'-terminal sequence GACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTAT
2011.08.28