Prev. |  KEGG KO K02896 > 

RIKEN DNA Bank Human Resource - RSL24D1

Gene ID NCBI Gene 51187 |  KEGG hsa:51187
Gene Symbol RSL24D1
Protein Name ribosomal L24 domain containing 1
Synonyms C15orf15|HRP-L30-iso|L30|RLP24|RPL24|RPL24L|TVAS3
Ortholog resources KEGG ortholog (KEGG orthology K02896) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011399 IRAK028I07 pCMV-SPORT6 BC012913 NM_016304 Full
HGY088434 IRAL021B10 pDNR-LIB BC008499 NM_016304 Full/var
HGY088620 IRAL021J04 pDNR-LIB BC009604 NM_016304 Full
HGY088621 IRAL021J05 pDNR-LIB BC008409 NM_016304 Full
HGY088717 IRAL021N05 pDNR-LIB BC008422 NM_016304 Full
HGY088727 IRAL021N15 pDNR-LIB BC009593 NM_016304 Full
HGY088731 IRAL021N19 pDNR-LIB BC008449 NM_016304 Full
HGY092508 IRAL031E12 pDNR-LIB BC014576 NM_016304 Full/var
HGY092840 IRAL032B16 pDNR-LIB BC016331 NM_016304 Full
HGY092895 IRAL032D23 pDNR-LIB BC016777 NM_016304 Full
HGY092960 IRAL032G16 pDNR-LIB BC016312 NM_016304 Full/var
HGY093001 IRAL032I09 pDNR-LIB BC028672 NM_016304 Full/var
HGY093045 IRAL032K05 pDNR-LIB BC016725 NM_016304 Full
HGY094228 IRAL035J12 pDNR-LIB BC026267 NM_016304 Full
HGY094238 IRAL035J22 pDNR-LIB BC026266 NM_016304 Full
HGY096602 IRAL041I10 pDNR-LIB BC035995 NM_016304 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209469 ARiS023L05 pGCAP10 NM_016304.2  
CGGCCGGCCGATGGTTTTTTTGGTGGGGTTACACGCGGGTTCAACATGCGTATCGAAAAG
HKR320951 RBb02G07 pKA1U5 NM_016304.2  
GACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTAT
HKR322073 RBb05D01 pKA1U5 NM_016304.2  
GCTCAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGCTATCGAAAA
HKR326907 RBb17E11 pKA1U5 NM_016304.2  
GACTTCCTCTCAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTATC
HKR330503 RBb26E07 pGCAP1 NM_016304.2  
GCTCTCAGCTTGGCGTTTGTTTGGTGGGGTCACACGCGGGTTCAACATGCGTATCGAAAA
HKR366479 RBd16D07 pGCAP10 NM_016304.2  
GCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTATCGAAA
HKR369202 RBd23A02 pGCAP10 NM_016304.2  
GACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTCACACGCGGGTTCAACATGCGTAT
HKR376452 RBd41C04 pGCAP10 NM_016304.2  
GGCATCACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATG
HKR377254 RBd43C06 pGCAP10 NM_016304.2  
GACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTCACACGCGGGTTCAACATGCGTAT
HKR382052 RBd55C04 pGCAP10 NM_016304.2  
GGACGGGGTTGCATCACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTCACACGCGGG
HKR405473 RBdS013L09 pGCAP10 NM_016304.2  
GAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTATCGAAAAGTGT
HKR416101 RBdS040E05 pGCAP10 NM_016304.2  
GAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTATCGAAAAGTGT
HKR430269 RBdS075L05 pGCAP10 NM_016304.2  
GTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTCACACGCGGGTTCAACATGCGTATCGA
HKR441881 RBdS104L17 pGCAP10 NM_016304.2  
GACTTCCTCTCAAGCTTGGCGTTTGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTAT
HKR452855 RBdS132C07 pGCAP10 NM_016304.2  
GGTTTGGTGGGGTTACACGCGGGTTCAACATGCGTATCGAAAAGTGTTATTTCTGTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl