Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083L12

Clone ID RBdS083L12
HP ID HP00153
Gene ID 6189
Gene Symbol RPS3A
Protein Name ribosomal protein S3A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001006.3
Length of RefSeq (bp) 930
Chromosome 4q31.2-q31.3
Reference DDBJ accession
UniGene Hs.356572
5'-terminal sequence GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
2011.08.28