Prev. |  KEGG KO K02984 > 

RIKEN DNA Bank Human Resource - RPS3A

Gene ID NCBI Gene 6189 |  KEGG hsa:6189
Gene Symbol RPS3A
Protein Name ribosomal protein S3A
Synonyms FTE1|MFTL|S3A
Ortholog resources KEGG ortholog (KEGG orthology K02984) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006375 IRAK015P15 pCMV-SPORT6 BC017123 NM_001006 Full
HGY066950 IRAK167G06 pBluescriptR BC066926 NM_001006 Full/var
HGY082597 IRAL006I05 pOTB7 BC000204 NM_001006 Full
HGY083968 IRAL009P08 pOTB7 BC004981 NM_001006 Full
HGY086805 IRAL017A05 pOTB7 BC006298 NM_001006 Full
HGY090026 IRAL025B02 pOTB7 BC009219 NM_001006 Full
HGY090773 IRAL026P13 pOTB7 BC009404 NM_001006 Full
HGY095925 IRAL039N13 pOTB7 BC030161 NM_001006 Full
HGY095929 IRAL039N17 pOTB7 BC019072 NM_001006 Full
HGY102990 IRAL057H22 pDNR-LIB BC070211 NM_001006 Full
HGY103455 IRAL058K15 pOTB7 BC071916 NM_001006 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081640 M01C004B16 pDONR221 04-134-2_2-H08 AK129825 NM_001006  
HGE081688 M01C004D16 pDONR221 04-134-2_2-H08 AK129825 NM_001006  
HGE081736 M01C004F16 pDONR221 04-134-2_2-H08 AK129825 NM_001006  
HGE081784 M01C004H16 pDONR221 04-134-2_2-H08 AK129825 NM_001006  
HGE081832 M01C004J16 pDONR221 04-134-2_2-H08 AK129825 NM_001006  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040835 ARe02B11 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR043752 ARe09G08 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR046580 ARe16H12 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR047299 ARe18E03 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR047770 ARe19H02 pKA1U5 NM_001006.3  
TGGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAA
HKR048502 ARe21E06 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR048825 ARe22B01 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR049251 ARe23C03 pKA1U5 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR049701 ARe24E05 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR052060 ARe30C12 pKA1U5 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR053654 ARe34C06 pKA1U5 NM_001006.3  
TGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR053750 ARe34G06 pKA1U5 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR054575 ARe36H07 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGCNTGNCAAGAACAAGCGCCTTACGAAAG
HKR054929 ARe37F09 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGCTTGGCAAGAACAAGCGCCTTACGAAA
HKR055236 ARe38B12 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR056405 ARe41A05 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR058401 ARe46A01 pKA1U5 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR058953 ARe47G09 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGNTGGCAAGAACAAGCGCCTTACGAAAGG
HKR059777 ARe49H09 pKA1U5 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR060898 ARe52E02 pKA1U5 NM_001006.3  
GCCCCTTTTGGCTCTCTGACCAGCACCATGGCGCGCTTGGCAAGAACAAGCGCCTTACGA
HKR060980 ARe52H12 pKA1U5 NM_001006.3  
TNTTTGCCCCTTTTGTNTCTNTGACCAGCACCNCGNTTNNTTTGGCANGNNCAAGCGCCT
HKR062058 ARe55C10 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGCNTGGTAAGAACAAGCGCCTTACGAAA
HKR062433 ARe56B09 pKA1U5 NM_001006.3  
CCCTTTTGGCTCTCTGACCAGCACCATGGCGGNCGGNAAGAACAAGCGCCTTACGAAAGG
HKR063283 ARe58D11 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR064025 ARe60B01 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR064027 ARe60B03 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGCTTGGCAAGAACAAGCGCCTTACGAAA
HKR064875 ARe62D03 pKA1U5 NM_001006.3  
GCCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR067297 ARe68E01 pKA1U5 NM_001006.3  
GGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAAGGGAG
HKR069230 ARe73B06 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTNGGNAAGAACAAGCGCCTTACGAAAGG
HKR071236 ARe78B12 pKA1U5 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR071307 ARe78E11 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR072556 ARe81G12 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR074145 ARe85G01 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR077322 ARe93F02 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR077777 ARe94H09 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR079379 ARe98H11 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR079649 ARe99C01 pKA1U5 NM_001006.3  
CCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR160459 ARi01C11 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR161234 ARi03B10 pGCAP10 NM_001006.3  
TTGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAA
HKR161756 ARi04G12 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR162528 ARi06F08 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR163348 ARi08G04 pGCAP10 NM_001006.3  
CCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR163374 ARi08H06 pGCAP10 NM_001006.3  
CCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR164505 ARi11E09 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR165675 ARi14D03 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR169306 ARi23E10 pGCAP10 NM_001006.3  
GCCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR170529 ARi26F09 pGCAP10 NM_001006.3  
CTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCG
HKR172458 ARi31C10 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR173353 ARi33G09 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR174102 ARi35E06 pGCAP10 NM_001006.3  
GCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR174571 ARi36H03 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR174899 ARi37E03 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR174976 ARi37H08 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR175611 ARi39A11 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR175636 ARi39B12 pGCAP10 NM_001006.3  
TNCCTTTTGGCTCTCTGCNCNCACCATGTCNNTNTGGNNNGAACAAGAGCCTTCATCNAT
HKR178501 ARi46E05 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR178506 ARi46E10 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR178835 ARi47B11 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR180500 ARi51E04 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR181725 ARi54F05 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR182408 ARi56A08 pGCAP10 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR182524 ARi56F04 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR184522 ARi61F02 pGCAP10 NM_001006.3  
CCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR185684 ARi64D12 pGCAP10 NM_001006.3  
HKR187306 ARi68E10 pGCAP10 NM_001006.3  
CCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR187701 ARi69E05 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR203259 ARiS008C11 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCNGNCCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR203372 ARiS008H04 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR203516 ARiS008N04 pGCAP10 NM_001006.3  
GTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAA
HKR208196 ARiS020I04 pGCAP10 NM_001006.3  
TGGGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGA
HKR208366 ARiS020P06 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR209266 ARiS023C18 pGCAP10 NM_001006.3  
CCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR209278 ARiS023D06 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR209465 ARiS023L01 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR209482 ARiS023L18 pGCAP10 NM_001006.3  
TGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR209546 ARiS023O10 pGCAP10 NM_001006.3  
CCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR219606 ARiS049A06 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR222316 ARiS055N04 pGCAP10 NM_001006.3  
CTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCG
HKR234201 ARiS085I09 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR234358 ARiS085O22 pGCAP10 NM_001006.3  
TGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR235203 ARiS088A03 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR235292 ARiS088D20 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR235345 ARiS088G01 pGCAP10 NM_001006.3  
TGCCTTTNGGCTCTCNGACCAGCACCATGGCGGTNNGCAAGAACAAGCGCCTTACGAAAG
HKR238499 ARiS096E03 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR238746 ARiS096O10 pGCAP10 NM_001006.3  
GCCTTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR243670 ARiS109C22 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR243768 ARiS109G24 pGCAP10 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR243984 ARiS109P24 pGCAP10 NM_001006.3  
CGGCCGGCCGATGGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCG
HKR247327 ARiS118F07 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR248829 ARiS122B05 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR248993 ARiS122I01 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR249149 ARiS122O13 pGCAP10 NM_001006.3  
CCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR264530 ARiS161F10 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR276419 ARiS191A19 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR276474 ARiS191D02 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR276680 ARiS191L16 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR279404 ARiS198I12 pGCAP10 NM_001006.3  
NGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR320452 RBb01C04 pKA1U5 NM_001006.3  
GCCCTTTTGCCTCTCTGACCATCCACCATGGCGGTTGGCAACAACNAGCGCCTTACGAAA
HKR320503 RBb01E07 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR321254 RBb03C06 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR321636 RBb04B12 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR321774 RBb04H06 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGCTTGNCAAGAACAAGCGCCTTACGAAA
HKR322036 RBb05B12 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR323746 RBb09G02 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGCTTGTGCAAGAACAAGCGCCTTACGAA
HKR324078 RBb10D06 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR324502 RBb11E06 pKA1U5 NM_001006.3  
ATCCTGGTGGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCT
HKR325260 RBb13C12 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR325656 RBb14C08 pKA1U5 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGCTTGGCAAGAACAAGCGCCTTACGAAA
HKR326451 RBb16C03 pKA1U5 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR326801 RBb17A01 pKA1U5 NM_001006.3  
TGGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAA
HKR329680 RBb24D08 pGCAP1 NM_001006.3  
GCCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR331673 RBb29D01 pGCAP1 NM_001006.3  
AAGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGATTGGCANGAACAAGCGCCTTACGA
HKR332976 RBb32H08 pGCAP1 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR333652 RBb34C04 pGCAP1 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR333656 RBb34C08 pGCAP1 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR333723 RBb34F03 pGCAP1 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR336851 RBb42C03 pGCAP1 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR341751 RBb54G07 pGCAP1 NM_001006.3  
TTTGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGA
HKR342132 RBb55F12 pGCAP1 NM_001006.3  
AGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR343301 RBb58E05 pGCAP1 NM_001006.3  
GCCACTTCCGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCC
HKR345632 RBb64B08 pGCAP1 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR346401 RBb66A01 pGCAP1 NM_001006.3  
CCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR346525 RBb66F05 pGCAP1 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR347723 RBb69F03 pGCAP1 NM_001006.3  
ACTTCCGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTA
HKR348900 RBb72E04 pGCAP1 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR360836 RBd02B12 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR360902 RBd02E06 pGCAP10 NM_001006.3  
GCCGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGA
HKR361375 RBd03H07 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR366411 RBd16A11 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR366501 RBd16E05 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR367680 RBd19D08 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR368908 RBd22E12 pGCAP10 NM_001006.3  
GCCTTTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAA
HKR370036 RBd25B12 pGCAP10 NM_001006.3  
GCTTTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR371772 RBd29H04 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR372101 RBd30E05 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR373208 RBd33A08 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR373610 RBd34A10 pGCAP10 NM_001006.3  
TGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR376873 RBd42D01 pGCAP10 NM_001006.3  
GGGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR377259 RBd43C11 pGCAP10 NM_001006.3  
TGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR377372 RBd43H04 pGCAP10 NM_001006.3  
CGGCCGGCCGATGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCG
HKR378056 RBd45C08 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR378499 RBd46E03 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR378825 RBd47B01 pGCAP10 NM_001006.3  
GGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAAGGGAG
HKR378878 RBd47D06 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR378976 RBd47H08 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR380828 RBd52B04 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR380875 RBd52D03 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR381752 RBd54G08 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR382430 RBd56B06 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACNNNCGCCTTACGAAAG
HKR382884 RBd57D12 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACANGCGCCTTACGAAAG
HKR383201 RBd58A01 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR383230 RBd58B06 pGCAP10 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGANCNNNCGCCTTACGAAAG
HKR383298 RBd58E02 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACANNCGCCTTACGAAAGG
HKR383354 RBd58G10 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR383629 RBd59B05 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR383679 RBd59D07 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR383697 RBd59E01 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCAGACCATCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR384802 RBd62A02 pGCAP10 NM_001006.3  
GCTTTTTTTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTAC
HKR386978 RBd67H10 pGCAP10 NM_001006.3  
GCCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR389771 RBd74H03 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR391608 RBd79A08 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR392955 RBd82G11 pGCAP10 NM_001006.3  
CGGCCGGCCGATGCCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAG
HKR394857 RBd87C09 pGCAP10 NM_001006.3  
CGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR396156 RBd90G12 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR396531 RBd91F11 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR397324 RBd93F04 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR402842 RBdS007B18 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR402962 RBdS007G18 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR405225 RBdS013B01 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR405768 RBdS014G24 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR405775 RBdS014H07 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR405807 RBdS014I15 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR405935 RBdS014N23 pGCAP10 NM_001006.3  
GCCTTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR408833 RBdS022B09 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR408853 RBdS022C05 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR408913 RBdS022E17 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR408993 RBdS022I01 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR416377 RBdS040P17 pGCAP10 NM_001006.3  
TGGGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGA
HKR420471 RBdS051C23 pGCAP10 NM_001006.3  
TGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAA
HKR428333 RBdS070N21 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR430272 RBdS075L08 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR432740 RBdS081O04 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR433476 RBdS083L12 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR441945 RBdS104O09 pGCAP10 NM_001006.3  
GGCNCCCCGCCCCCGTACGCCTAAGTTCTCGCGCGACTCCCACTTCCGCCCTTTTGGCTC
HKR442335 RBdS105N23 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR452803 RBdS132A03 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR461651 RBdS154C03 pGCAP10 NM_001006.3  
TGCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR461790 RBdS154H22 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR461949 RBdS154O13 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR462451 RBdS156C03 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR462705 RBdS156M17 pGCAP10 NM_001006.3  
CGGCCGGCCGATGCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGC
HKR462752 RBdS156O16 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG
HKR470907 RBdS177E11 pGCAP10 NM_001006.3  
GCCCTTTTGNCTCNCTNACCANCACCTTGGCGGTTGGCAAGAACANGCGCCTTACGAAAG
HKR471020 RBdS177J04 pGCAP10 NM_001006.3  
GCCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAG
HKR471149 RBdS177O13 pGCAP10 NM_001006.3  
GCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGC
HKR475052 RBdS187K12 pGCAP10 NM_001006.3  
GCCTTTTGGCTCTCTGACCAGCACCATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl