Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083K10

Clone ID RBdS083K10
HP ID HP06998
Gene ID 10556
Gene Symbol RPP30
Protein Name ribonuclease P/MRP 30kDa subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006413.4
Length of RefSeq (bp) 2371
Chromosome 10q23.31
Reference DDBJ accession
UniGene Hs.139120
5'-terminal sequence GATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGA
2011.08.28