Prev. |  KEGG KO K03539 > 

RIKEN DNA Bank Human Resource - RPP30

Gene ID NCBI Gene 10556 |  KEGG hsa:10556
Gene Symbol RPP30
Protein Name ribonuclease P/MRP subunit p30
Synonyms TSG15
Ortholog resources KEGG ortholog (KEGG orthology K03539) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086515 IRAL016E19 pDNR-LIB BC006991 NM_006413 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037386 W01A093H18 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE037388 W01A093H20 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE037420 W01A093J04 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE037426 W01A093J10 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE037430 W01A093J14 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE037434 W01A093J18 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE037436 W01A093J20 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE045774 W01A114H06 pENTR-TOPO IRAL016E19 BC006991 NM_006413  
HGE045776 W01A114H08 pENTR-TOPO IRAL016E19 BC006991 NM_006413  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR189776 ARi74H08 pGCAP10 NM_006413.4  
CGGCCGGCCGATGATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGG
HKR377630 RBd44B06 pGCAP10 NM_006413.4  
GGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAG
HKR433450 RBdS083K10 pGCAP10 NM_006413.4  
GATGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl