Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083F05

Clone ID RBdS083F05
HP ID HP00029
Gene ID 387
Gene Symbol RHOA
Protein Name ras homolog gene family, member A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001664.2
Length of RefSeq (bp) 1926
Chromosome 3p21.3
Reference DDBJ accession
UniGene Hs.247077
5'-terminal sequence GCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCC
2011.08.28