Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RHOA

Gene ID (NCBI) 387
Gene Symbol RHOA
Protein Name ras homolog family member A
Synonyms ARH12|ARHA|RHO12|RHOH12
Databases KEGG hsa:387 |  NCBI Gene 387
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Endocytosis (human)
Featured content T cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04513)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07404 pGL4-phRHOA Promoter collection, Human RHOA promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001566 IRAK003P06 pCMV-SPORT6 BC000946 NM_001664 Partial
HGY081617 IRAL004A17 pOTB7 BC001360 NM_001664 Full
HGY088769 IRAL021P09 pDNR-LIB BC005976 NM_001664 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE036478 W01A091D06 pENTR-TOPO IRAL021P09 BC005976 NM_001664 done
HGE036482 W01A091D10 pENTR-TOPO IRAL021P09 BC005976 NM_001664  
HGE036488 W01A091D16 pENTR-TOPO IRAL021P09 BC005976 NM_001664  
HGE036490 W01A091D18 pENTR-TOPO IRAL021P09 BC005976 NM_001664  
HGE036492 W01A091D20 pENTR-TOPO IRAL021P09 BC005976 NM_001664  
HGE036494 W01A091D22 pENTR-TOPO IRAL021P09 BC005976 NM_001664  
HGE036496 W01A091D24 pENTR-TOPO IRAL021P09 BC005976 NM_001664  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043606 ARe09A06 pKA1U5 NM_001664.2  
GGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGATCCTCCGTCGGTTCTC
HKR045299 ARe13E03 pKA1U5 NM_001664.2  
TGGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCG
HKR049681 ARe24D09 pKA1U5 NM_001664.2  
ATCCTGGGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTC
HKR061321 ARe53F01 pKA1U5 NM_001664.2  
GGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGNTCGGTTCTCTCGATTAGTCCACGGNTC
HKR064058 ARe60C10 pKA1U5 NM_001664.2  
GCCCCGCCCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCG
HKR066032 ARe65B08 pKA1U5 NM_001664.2  
CNCGCGCACCCTCCCGCCGCCCGCGGTCCTCCNTCGGNACTCTCGTAAGTCCACGGTCTC
HKR069234 ARe73B10 pKA1U5 NM_001664.2  
GCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTTCGGTTCTCTCGTTAGTCCACG
HKR079300 ARe98E04 pKA1U5 NM_001664.2  
GGTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCG
HKR162050 ARi05C02 pGCAP10 NM_001664.2  
CGGCCGGCCGATGGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTC
HKR162899 ARi07E03 pGCAP10 NM_001664.2  
GGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCT
HKR162903 ARi07E07 pGCAP10 NM_001664.2  
GGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGG
HKR167210 ARi18A10 pGCAP10 NM_001664.2  
GACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGGTCTTC
HKR169723 ARi24F03 pGCAP10 NM_001664.2  
GGGTTCCCCGCCCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCNNNACCCTCCCGCCGCC
HKR170851 ARi27C03 pGCAP10 NM_001664.2  
GGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCC
HKR178499 ARi46E03 pGCAP10 NM_001664.2  
GGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCT
HKR182834 ARi57B10 pGCAP10 NM_001664.2  
GGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGG
HKR219660 ARiS049C12 pGCAP10 NM_001664.2  
GGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCA
HKR219741 ARiS049F21 pGCAP10 NM_001664.2  
GGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGG
HKR219819 ARiS049J03 pGCAP10 NM_001664.2  
GGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGG
HKR235583 ARiS088P23 pGCAP10 NM_001664.2  
GCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCAC
HKR243982 ARiS109P22 pGCAP10 NM_001664.2  
GTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGT
HKR320946 RBb02G02 pKA1U5 NM_001664.2  
GGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGATCGGTT
HKR336474 RBb41D02 pGCAP1 NM_001664.2  
TTGCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCAC
HKR374425 RBd36B01 pGCAP10 NM_001664.2  
GGCCGCCGCCCGCCCTCGTTCTCTAGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGG
HKR387652 RBd69C04 pGCAP10 NM_001664.2  
GGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTC
HKR416361 RBdS040P01 pGCAP10 NM_001664.2  
GGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCA
HKR433325 RBdS083F05 pGCAP10 NM_001664.2  
GCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCC
HKR461816 RBdS154I24 pGCAP10 NM_001664.2  
GCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGT
HKR462766 RBdS156P06 pGCAP10 NM_001664.2  
GCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl