Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083E10

Clone ID RBdS083E10
HP ID HP06364
Gene ID 5981
Gene Symbol RFC1
Protein Name replication factor C (activator 1) 1, 145kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002913.3
Length of RefSeq (bp) 4925
Chromosome 4p14-p13
Reference DDBJ accession
UniGene Hs.507475
5'-terminal sequence GGTTGCTGGCTTTGAAGATGCAGGAAGGGTCTTTGAGCCAAGAATGCTGGCATCCACTGG
2011.08.28