Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RFC1

Gene ID (NCBI) 5981
Gene Symbol RFC1
Protein Name replication factor C (activator 1) 1, 145kDa
Synonyms A1|MHCBFB|PO-GA|RECC1|RFC|RFC140
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010484 IRAK026D12 pCMV-SPORT6 BC035297 NM_002913 Full/var
HGX039487 IRAK098L23 pCMV-SPORT6 BC051751 NM_002913 Full
HGX042931 IRAK107F11 pCMV-SPORT6 BC051786 NM_002913 Full/var
HGY087649 IRAL019C01 pDNR-LIB BC010387 NM_002913 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE023132 W01A057N20 pENTR-TOPO IRAK098L23 BC051751 NM_002913

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR124057 ARh10C09 pGCAP1 NM_002913.3
GGTTGGCGCGAATGGATCCTGAGCCTCGATAACAGATTCCTCAACCGGCCCACCCGCCAG
HKR362529 RBd06F09 pGCAP10 NM_002913.3
GGTCTTCGCCTTCTTGCACTTCGCGGGAGAAGTTGTTGGCGCGAATGGATCCTGAGCCTC
HKR433306 RBdS083E10 pGCAP10 NM_002913.3
GGTTGCTGGCTTTGAAGATGCAGGAAGGGTCTTTGAGCCAAGAATGCTGGCATCCACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl