Prev. |  KEGG KO K10754 > 

RIKEN DNA Bank Human Resource - RFC1

Gene ID NCBI Gene 5981 |  KEGG hsa:5981
Gene Symbol RFC1
Protein Name replication factor C subunit 1
Synonyms A1|CANVAS|MHCBFB|PO-GA|RECC1|RFC|RFC140
Featured content DNA repair (human)
Ortholog resource in our bank

  RFC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010484 IRAK026D12 pCMV-SPORT6 BC035297 NM_002913 Full/var
HGX039487 IRAK098L23 pCMV-SPORT6 BC051751 NM_002913 Full
HGX042931 IRAK107F11 pCMV-SPORT6 BC051786 NM_002913 Full/var
HGY087649 IRAL019C01 pDNR-LIB BC010387 NM_002913 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023132 W01A057N20 pENTR-TOPO IRAK098L23 BC051751 NM_002913  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124057 ARh10C09 pGCAP1 NM_002913.3  
GGTTGGCGCGAATGGATCCTGAGCCTCGATAACAGATTCCTCAACCGGCCCACCCGCCAG
HKR362529 RBd06F09 pGCAP10 NM_002913.3  
GGTCTTCGCCTTCTTGCACTTCGCGGGAGAAGTTGTTGGCGCGAATGGATCCTGAGCCTC
HKR433306 RBdS083E10 pGCAP10 NM_002913.3  
GGTTGCTGGCTTTGAAGATGCAGGAAGGGTCTTTGAGCCAAGAATGCTGGCATCCACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl