Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081K24

Clone ID RBdS081K24
HP ID HP01037
Gene ID 1104
Gene Symbol RCC1
Protein Name regulator of chromosome condensation 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001269.3
Length of RefSeq (bp) 2439
Chromosome 1p36.1
Reference DDBJ accession
UniGene Hs.469723
5'-terminal sequence GCCTTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGATTTGTTAAGGATTC
2011.08.28