Prev. |  KEGG KO K11493 > 

RIKEN DNA Bank Human Resource - RCC1

Gene ID NCBI Gene 1104 |  KEGG hsa:1104
Gene Symbol RCC1
Protein Name regulator of chromosome condensation 1
Synonyms CHC1|RCC1-I|SNHG3-RCC1
Ortholog resources KEGG ortholog (KEGG orthology K11493) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01658 RCC1 genomic DNA clone B95 Cosmid clone of genomic DNA of human RCC1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001465 IRAK003L01 pCMV-SPORT6 BC006790 NM_001269 Partial/var
HGX031230 IRAK078B06 pCMV-SPORT6 BC036903 NM_001269 Full
HGY089138 IRAL022O02 pOTB7 BC007300 NM_001269 Full
HGY091097 IRAL027M09 pOTB7 BC010067 NM_001269 Full
HGY091924 IRAL029N12 pOTB7 BC012122 NM_001269 Partial/var
HGY095741 IRAL039F21 pOTB7 BC017334 NM_001269 Partial/var
HGY101979 IRAL054P19 pOTB7 BC069198 NM_001269 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065636 ARe64B12 pKA1U5 NM_001269.3  
GCCTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGATTTGTTAAGGATTCC
HKR162428 ARi06B04 pGCAP10 NM_001269.3  
GCCTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGTAAGTGTGATCCTTGG
HKR177277 ARi43D05 pGCAP10 NM_001269.3  
TGCCTTTTTGGAGACNGATTCGCANTGGTCGCTTCTTCTCCTTGGATTTGTNAAGGATTC
HKR234198 ARiS085I06 pGCAP10 NM_001269.3  
CGGCCGGCCGATGCTTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGATTT
HKR390973 RBd77H05 pGCAP10 NM_001269.3  
GCCTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGATTTGTTAAGGATTCC
HKR432664 RBdS081K24 pGCAP10 NM_001269.3  
GCCTTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGATTTGTTAAGGATTC
HKR461797 RBdS154I05 pGCAP10 NM_001269.3  
GCCTTTTTGGAGACAGATTCGCAGTGGTCGCTTCTTCTCCTTGGATTTGTTAAGGATTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl